Xab2-funktioner vid mitotisk cellcykelprogression via transkriptionell reglering av cenpe | celldöd och sjukdom

Xab2-funktioner vid mitotisk cellcykelprogression via transkriptionell reglering av cenpe | celldöd och sjukdom

Anonim

ämnen

  • Cancerterapi
  • Cell signalering
  • mitos
  • Transkription

Abstrakt

Xeroderma pigmentosum group A (XPA) -bindande protein 2 (XAB2) är ett multifunktionellt protein som spelar en avgörande roll i processer inklusive transkription, transkriptionskopplad DNA-reparation, pre-mRNA-skarvning, homolog rekombination och mRNA-export. Microarray-analys på genuttryck i XAB2-knockdownceller avslöjar att många gener med signifikant förändring i uttrycksfunktionen vid mitotisk cellcykelreglering. Fluorescensaktiverad cellscanneranalys bekräftade XAB2-utarmning ledde till cellstopp i G2 / M-fas, mestadels vid profas eller prometafas. Levande cellavbildning avslöjade vidare att XAB2-knockdown inducerade allvarliga mitotiska defekter inklusive kromosom-inriktning och defekter i segregering, vilket ledde till mitotiskt arrest, mitotisk katastrof och efterföljande celldöd. Bland de toppgener som regleras ned genom XAB2-utarmning är mitotiskt motorproteincentrosomassocierat protein E (CENPE). Knockdown CENPE visade liknande fenotyper som förlust av XAB2, men CENPE-knockdown följt av XAB2-utarmning förstärkte inte ytterligare cellcykelstopp. Luciferasanalys på CENPE-promotor visade att överuttryck av XAB2 ökade luciferasaktiviteten, medan XAB2-utarmning resulterade i slående minskning av luciferasaktiviteten. Ytterligare kartläggning avslöjade en region i CENPE-promotor som krävs för transkriptionell reglering genom XAB2. Dessutom visade ChIP-analys att XAB2 interagerade med CENPE-promotor. Tillsammans stöder dessa resultat en ny funktion av XAB2 vid mitotisk cellcykelreglering, som delvis förmedlas genom transkriptionsreglering på CENPE.

Huvudsaklig

Xeroderma pigmentosum-grupp A (XPA) -bindande protein 2 (XAB2) är en mycket konserverad gen, som ursprungligen identifierades i människa som ett protein som interagerar med XPA med användning av tvåhybrid-jästsystem. 1 Den humana XAB2-genen är belägen på kromosom 19p13.2 och kodar ett protein av 855 aminosyror med en molekylvikt av 100 kDa. XAB2-proteinet innehåller 15 tetratricopeptidupprepade motiv som är involverade i protein-protein-interaktioner och sammansättningen av multiproteinkomplex. Det har många ortologer, såsom SYF1 i Saccharomyces cerevisiae , 2, 3 ATH55 i råtta 4 och Fandango i Drosophila. 5

Det rapporterades att XAB2 kunde interagera med Cockayne syndrom grupp A och B (CSA och CSB) proteiner såväl som RNA-polymeras II, och nedreglering av XAB2 med användning av anti-XAB2-antikropp eller siRNA, vilket både inhiberade normal RNA-syntes och återhämtning av RNA-syntes efter UV-bestrålning, vilket indikerar att XAB2 är involverad i transkription och transkriptionskopplad DNA-reparation. 1, 6 Ytterligare studier visade att XAB2 kan binda till hyperfosforylerad form av RNA-polymeras II på ett UV- och CSA / CSB-beroende sätt 7 och bidra till transkriptionförlängning. 6 Vidare impliceras XAB2 som en komponent i Prp19 / XAB2-komplex 6 (hAquarius, XAB2, Prp19, CCDC16, hISY1 och PPIE) eller Prp19 / CDC5L-relaterat komplex 8 som krävs för pre-mRNA-skarvning. Under skarvning rekryteras Prp19-komplexet till spliceosomen och är avgörande för aktivering av spliceosom genom att stabilisera U5 och U6 med spliceosomen efter U4-dissociation. 9, 10 I Hela-celler rapporterades Prp19 / XAB2-komplex att associeras med RNA snarare än DNA, och knockdown av XAB2 skulle hämma Bcl-x pre-mRNA-skarvning. 6 På liknande sätt identifieras SYF1, homolog av XAB2 i jäst, också som en faktor som är involverad i pre-mRNA-skarvning, 2, 3 och en ny transkriptionsförlängningsfaktor genom att koppla Prp19-komplexet med RNA-polymeras II genom dess C-terminala domän. 11

XAB2 är också viktigt för tidig musembryogenes, eftersom knockdown av XAB2 hos möss har visat sig leda till embryonal dödlighet. 12 Det visades tidigare att XAB2 kunde interagera med retinsyra-receptor A och histondeacetylas 3, och XAB2-brist ökade all-trans retinsyra (ATRA) -inducerad celldifferentiering i ATRA-känsliga och-resistenta cancerceller. Dessa resultat antyder att XAB2 kan uppvisa en hämmande effekt vid ATRA-inducerad cellulär differentiering. 13 Dessutom kan XAB2 spela en roll i tumörgenes. XAB2-uttryck är signifikant nedreglerat i primär magcancer, 14 trippelnativ bröstcancer 15 och en långvarig överlevande av en atypisk teratoid / rhabdoid tumör, 16 medan den är uppreglerad i äggstockscancer 17 och sarkom 18 med användning av Oncomine-databasen (www.oncomine .org). XAB2-taggenNP: er (rs794078 och rs4134816) är dramatiskt korrelerade med risken för icke-småcellig lungcancer i den kinesiska befolkningen. 19 Dessutom reduceras XAB2-nivåerna påfallande i åldrande hematopoietiska stamceller, vilket antyder en roll i åldrandet. 20 Nyligen visade vi att XAB2 presenterat i ribonukleoproteinet i ett konsensuselement som finns i naturligt intronlösa mRNA som kan främja mRNA-export, och störning av XAB2 ledde till kärnhållning av de intronlösa mRNA: erna, vilket antyder en roll av XAB2 i naturligt intronfritt mRNA exportera. 21 Senast har XAB2 rapporterats reglera slutresektionssteget under homolog rekombinationsreparation av kromosomala dubbelsträngsbrott. 22 Således är XAB2 ett viktigt multifunktionellt protein.

Trots de kritiska funktionerna hos XAB2 vid genuttryck är målgenerna nedströms och de efterföljande fysiologiska rollerna i mänskliga celler fortfarande okända. Här utför vi mikroarrayanalys på Hela-celler transfekterade med XAB2 shRNA, vilket avslöjar att XAB2 modulerar uttrycket av ett betydande antal gener, mest involverade i cellcykel och mitotisk progression. Vi visar vidare att XAB2-knockdown orsakar kromosomfelinställning och missreglering, onormal kärnstruktur, spindelpol och mikrotubulär organisation, vilket leder till mitotisk arrestering, mitotisk katastrof och efterföljande celldöd. Mekanisk analys avslöjar att fenotypen som observerats i XAB2-utarmningsceller medieras av ett kinesinliknande motorprotein som kallas centrosomassocierat protein E (CENPE), vars transkription regleras av XAB2. Sammantaget indikerar våra data att XAB2 reglerar mitotisk progression genom transkriptionskontroll av CENPE.

Resultat

Microarray-analys avslöjar att XAB2-knockdown resulterar i avvikande uttryck för många gener involverade i mitotisk cellcykel

Tidigare studier indikerade att XAB2 är ett multifunktionellt protein som spelar en avgörande roll vid transkription, 6 skarvning 6 och mRNA-export. 21 För att identifiera målgener som regleras av XAB2 analyserades genuttryck av XAB2-utarmade HeLa-celler med mikroarray. Denna analys avslöjade att totalt 690 gener uppvisade signifikant förändring i uttrycket (> 2-faldigt, P <0, 05). Bland dem var 216 gener uppreglerade och 474 gener nedreglerades (kompletterande tabell 1). Utnyttjningseffektiviteten för XAB2 bekräftades med western blot (figur la) på proteinnivå såväl som med mikroarray på mRNA-nivå (kompletterande tabell 1, nedreglerad 3, 43-faldig). För att verifiera mikroarray-data användes RT-PCR för att kontrollera expressionsnivån för flera gener inklusive MAPK4, SERPINB5, EPGN och PRG4. I överensstämmelse med mikroarray-resultaten bekräftades reducerat uttryck av dessa fyra gener med RT-PCR (kompletterande figur S1).

Microarray-analys avslöjar gener involverade i cellcykel och mitotisk progression som huvudgener med uttrycksförändringar efter XAB2-knockdown. ( a ) Genontologianalys som visar genfunktioner med signifikanta förändringar i uttryck efter XAB2-knockdown. Höger-nedre panel: Western blot som visade XAB2 tömdes effektivt efter att celler infekterats med lentivirus innehållande XAB2 shRNA. ( b ) Differentialuttryck av gener (> 2-faldigt, P <0, 05) relaterat till cellcykel och mitotisk progression efter XAB2-knockdown. ( c ) RT-PCR-analys validerade genuttrycksnivåer efter XAB2-knockdown

Bild i full storlek

Därefter utfördes genontologianalys för att analysera de biologiska funktionerna i 690 gener med förändrat uttryck. Såsom visas i figur la var flera påverkade toppfunktioner relaterade till cellcykelreglering, inklusive mitotisk cellcykel, M-fas i mitotisk cellcykel, mitotisk prometafas och celldelning. Följaktligen avreglerades en uppsättning gener involverade i regleringen av cellcykeln (figur Ib), inklusive CENPE, CKAP5, CLIP1, CDC27 och Mad2L1, vars uttryck validerades med RT-PCR (figur 1c). Tillsammans föreslog dessa data en kritisk roll av XAB2 i mitos och cellcykelreglering.

XAB2-knockdown leder till mitotisk arrestering, mitotisk katastrof och celldöd

För att ytterligare undersöka om XAB2 reglerar cellcykeln och mitotisk progression utfördes fluorescensaktiverad cellscanner (FACS) -analys på Hela-celler transfekterade med XAB2 shRNA. Påfallande resulterade XAB2-knockdown i en signifikant ökning av celler som arresterades i G2 / M-fas (32, 8% i XAB2-shRNA-transfekterade celler jämfört med 10, 6% i kontroll, P <0, 001, figur 2a och b). För att utesluta effekter utanför målet av XAB2 shRNA testades ytterligare en shRNA och två siRNA för deras effekter på cellcykeln. På liknande sätt resulterade knockdown XAB2 med användning av olika shRNA eller siRNA i signifikant cellcykelstopp vid G2 / M-fas i både Hela (kompletterande figur S2A) och 293T-celler (kompletterande figur S2B), vilket indikerar att cellcykelstopp är en viktig defekt efter XAB2-utarmning. Konsekvent ökade uttrycket av mitotiska markörer Cyclin B1 och Fosfo-HistoneH3 (Ser10) uppenbarligen i XAB2-knockdownceller med western blot (figur 2c) och FACS-analys (kompletterande figur S2C).

XAB2-brist orsakar mitotisk arrestering, mitotisk katastrof och celldöd. ( a ) Nedbrytning av XAB2 resulterar i ansamling av G2 / M-celler genom FACS-analys. Hela-celler transfekterades med kontroll-shRNA (shNC) eller XAB2-shRNA (shXAB2) och färgades sedan med PI för analys av cellcykeldistributionen. ( b ) Kvantifiering av celler i olika cellcykelfaser efter XAB2-utarmning ( n = 3); *** P ≤0, 001. ( c ) Western blot avslöjar uppreglering av CyclinB1 och Phospho-HistoneH3 (Ser10) i XAB2-utarmade celler. ( d ) XAB2-knockdown inducerar signifikant ökning av celler i profas och prometafas. Hela-celler transfekterades med kontroll-shRNA (shNC) eller XAB2-shRNA (shXAB2) och immunofärgades sedan med a- tubulinantikropp och DAPI. ( e ) Kvantifiering av mitotiska celler i olika faser efter XAB2-utarmning. Mer än 100 slumpmässigt utvalda mitotiska celler räknades ( n = 3). ( f ) Live cellavbildning som visade XAB2-knockdown resulterade i mitotiskt arrest och celldöd. ( g ) Kvantifiering av den genomsnittliga mitosvaraktigheten för GFP-H2B Hela-celler med kontroll eller XAB2-knockdown ( n = 30 celler); *** P ≤0, 001 (NEB: nedbrytning av kärnkraft). ( h ) Kvantifiering av celler i mitotisk stopp eller mitotisk försening (mitosvaraktighet> 90 min) som observerats vid levande cellavbildning. Mitosvaraktigheten definieras som tidsförloppet från nedbrytning av nukleärt hölje till början av anafas eller celldöd; *** P ≤0, 001. ( i ) Kvantifiering av mitotiska dödsceller efter XAB2-utarmning. Mer än 50 slumpmässigt utvalda mitotiska celler räknades ( n = 3); *** P ≤0, 001. ( j ) XAB2-knockdown orsakar apoptos genom FACS-analys med användning av annexin V- och PI-färgning. ( k ) Kvantifiering av annexin V-positiva celler efter XAB2-utarmning ( n = 3); ** P <0, 01

Bild i full storlek

Därefter färgades XAB2-knockdownceller och kontrollceller med antikropp mot tubulin och DAPI, signifikanta mitotiska celler arresterade vid profas och prometafas observerades i celler med XAB2-utarmning (82, 8 mot 15, 1% i kontroll, P <0, 001, figur 2d och e), ytterligare stöd för allvarliga defekter i mitotisk cellcykelprogression.

För att bättre undersöka funktionen av XAB2 på mitotisk progression tappade vi XAB2 i HeLa-celler stabilt uttryckande GFP-H2B och spårade mitos med hjälp av levande cellavbildning. Såsom visas i figur 2f separerades två dotterkärnor under 50 minuter och mitos fullbordades med 70 minuter i kontrollceller. I motsats härtill observerades inte kärnseparation ens 300 minuter i XAB2-utarmade celler. Statistisk analys avslöjade vidare att den genomsnittliga mitosvaraktigheten från kärnhöljesdelning till anafas förlängdes från ~ 60 min i kontrollceller till 290 min i celler med XAB2-utarmning (figur 2g, P 90 min) höjdes dramatiskt från 4, 9 till 81, 2% ( Figur 2h, P <0, 001). Dessutom ökades celler som genomgick mitotisk celldöd signifikant efter XAB2-nedslagning från 3, 9 till 65, 8% (figur 2i, P <0, 001). För att ytterligare testa huruvida XAB2-knockdown inducerade celldöd efter mitotisk katastrof utfördes FACS-analys efter annexin V och propidiumjodid (PI) -färgning. Såsom visas i figurerna 2j och k ökade uppenbarligen andelen V-positiva celler av annexin i XAB2-knockdownceller från 5, 8 till 24, 7%, vilket antyder betydande celldöd efter XAB2-utarmning. Sammantaget indikerade dessa data att XAB2-brist resulterade i mitotisk arrestering, mitotisk katastrof och celldöd.

XAB2-knockdown orsakar kromosominriktning och segregeringsdefekter

Eftersom mitos kräver en noggrann kontroll av kromosomrörelse utförde vi nästa DAPI-färgning för att bestämma om XAB2 påverkar kromosominställning och segregering. Denna analys avslöjade allvarlig kromosom-inriktning vid ekvatorialplatta och internukleära DNA-broar (figur 3a).

XAB2-knockdown leder till feljustering av kromosomer och missreglering. ( a ) Felinställda / missegregerade kromosomer och internukleära broar observerade i XAB2-utarmade celler. ( b ) Levande cellavbildning som visade XAB2-knockdown resulterade i mitotiskt arresterande, mitotisk försening och segregeringsdefekt. ( c ) Kvantifiering av mitotiska celler efter XAB2-utarmning visade signifikant ökning av mitotisk stopp, mitotisk fördröjning och segregeringsdefekt

Bild i full storlek

I överensstämmelse med tidigare observationer uppvisade de flesta av de mitotiska cellerna mitotisk stopp, mitotisk försening eller segregeringsdefekt. Specifikt observerades mitotisk stopp i profas eller prometafas med defekter i kromosominriktning i 43, 1% av mitotiska celler efter XAB2-utarmning jämfört med 2, 6% i kontroll, som inte delade sig och ledde till slut till celldöd (figurerna 3b och c). Mitotisk fördröjning observerades i 33, 2% av mitotiska celler efter XAB2-knockdown kontra 4, 2% i kontroll, dessa celler kunde fortfarande dela sig efter en mitotisk fördröjning med kromosom-inriktning, men också med kromosomsegregationsdefekt resulterande i bildandet av internukleära DNA-broar (figurer 3b och c). Medan segregeringsdefekt utan kromosom-inriktning observerades också i 16, 3% av mitotiska celler i jämförelse med 6, 9% i kontroll (figur 3b och c). Båda cellerna med mitotisk fördröjning eller segregeringsdefekt uppvisade onormal kärnstruktur och dog i cellcykelprogression (figur 3b). Dessa data indikerade allvarliga fel i kromosominriktning och segregering efter XAB2-knockdown.

XAB2-brist inducerar onormal spindelpol, kärnstruktur och mikrotubulär organisation och DNA-brytningar

Vi försökte vidare undersöka hur mitos störs i XAB2-knockdownceller. Först kontrollerades spindelpolen i XAB2-utarmade celler eftersom korrekt spindelbildning krävs för kromosominriktning och segregering. Påfallande observerades enstaka eller flera spindelpolar i ~ 30 och ~ 8% av profas / prometafasceller efter XAB2-knockdown med användning av antingen tubulin eller Aurora A-färgning (figur 4a och b). För det andra observerades onormala kärnstrukturer inklusive kärnkraft, jordnötsform eller oregelbunden kärna i de flesta mellanfasceller efter XAB2-utarmning (figur 4c). Samtidigt stördes också mikrotubulärorganisationen allvarligt. Clustered oregelbunden sammansättning av mikrotubuli observerades vid ena sidan av kärnan jämfört med en jämn fördelning i kontrollceller (figur 4c). För det tredje undersöktes DNA-skador i XAB2-knockdownceller, eftersom kärnkraftverk i allmänhet är förknippade med DNA-brytningar. 23, 24 Såsom visas i figurerna 4d och e ökades uttrycket av DNA-skada-markören Phospho-Histone H2A.X ( y- H2A.X) signifikant i XAB2-knockdownceller genom både immunfluorescensfärgning och Western blot-analys. Tillsammans antydde dessa data att XAB2 var kritisk för mikrotubulär och spindelorganisation såväl som genomstabilitet.

XAB2-knockdown resulterar i avvikande spindelpol, störd mikrotubulär organisation och ökad DNA-skada. ( a, b ) Nedbrytning av XAB2 leder till enstaka eller flera spindelpoler i profas- eller prometafasceller. Hela-celler transfekterades med kontroll-shRNA (shNC) eller XAB2-shRNA (shXAB2) och immunofärgades sedan med a- tubulinantikropp ( a ) eller Aurora A-antikropp ( b ) och DAPI. ( c ) Stört mikrotubulär organisation och kärnstruktur i mellanfasceller efter XAB2-knockdown. Hela-celler immunfargades med a- tubulinantikropp (grön) och DAPI (blå). ( d ) XAB2-knockdown resulterar i ökade DNA-brytningar, vilket visades genom immunfärgning med användning av y- H2A.X-antikropp (grön). ( e ) Western blot avslöjar uppreglering av y- H2A.X i XAB2-knockdownceller

Bild i full storlek

Defekter i mitotisk progression i XAB2-utarmningsceller medieras av CENPE

Därefter planerar vi att utforska mekanismen för hur XAB2 reglerar mitos. Vi märkte att CENPE, en nyckelfaktor för mitos, var bland de bästa generna nedreglerade i XAB2 knockdown-mikroarray-resultat. Därför testade vi hypotesen att XAB2 reglerar mitos via CENPE. Först verifierades expressionsnivån för CENPE i XAB2-utarmade celler genom RT-PCR och Western blot-analys, resultaten indikerade att XAB2-utarmning ledde till en dramatisk förlust av CENPE i både mRNA- och proteinnivå (figur 1c och 5a, kompletterande figur S3) . Medan knockdown-CENPE visade ingen effekt på XAB2-proteinuttryck, vilket tyder på XAB2-funktioner uppströms om CENPE (figur 5b). Därefter tappades CENPE i HeLa-celler med användning av CENPE-specifikt siRNA, utarmningen ledde till 50, 0% av cellerna arresterade vid G2 / M-fasen jämfört med 19, 0% i kontroll (figur 5c och d, P <0, 001). Under tiden inducerade CENPE-uttömning också kromosomfällning och profas / prometafasstopp (78, 1% i knockdownceller kontra 17, 2% i kontroll), liknande fenotypen som observerades i XAB2-bristceller (figurerna 5e och f). För att ytterligare bekräfta om XAB2 reglerar mitos via CENPE, behandlades HeLa-celler med CENPE siRNA följt av utarmning av XAB2. Såsom visas i figur 5g arresterade CENPE-knockdown ensam dramatiskt celler i G2 / M-fas, medan CENPE-knockdown följt av XAB2-shRNA-behandling inte ytterligare förstärkte G2 / M-arresteringen orsakad av CENPE, vilket illustrerar den viktiga rollen för CENPE i den mitotiska progressionskontrollen. inducerad av XAB2-utarmning. Tillsammans antydde dessa resultat att XAB2 reglerade mitos via CENPE.

XAB2 reglerar mitotisk progression via CENPE. ( a ) Western blot som visar minskat uttryck av CENPE-protein i XAB2-knockdownceller. ( b ) Western blot som visade knockdown av CENPE förändrade inte nivån av XAB2-protein. ( c ) CENPE-knockdown leder till G2 / M-arrest som avslöjats genom FACS-analys. Hela-celler transfekterades med kontroll siRNA (siNC) eller CENPE siRNA (siCENPE) och färgades sedan med PI för att analysera cellcykelfördelningen. ( d ) Kvantifiering av celler i olika cellcykelfaser efter CENPE-utarmning ( n = 3); *** P ≤0, 001. ( e ) Immunofluorescensfärgning visar signifikant ökning av celler i profas och prometafas efter knocking av CENPE. Hela-celler transfekterades med kontroll siRNA (siNC) eller CENPE siRNA (siCENPE) och immunofärgades sedan med a- tubulinantikropp och DAPI. ( f ) Kvantifiering av mitotiska celler i olika faser efter CENPE-utarmning. Mer än 50 slumpmässigt utvalda mitotiska celler räknades ( n = 3). ( g ) CENPE-knockdown följt av XAB2-shRNA-behandling ökar inte ytterligare G2 / M-arresteringen inducerad av CENPE-utarmning. ( n = 3); * P 0.05

Bild i full storlek

XAB2 reglerar CENPE-uttryck på transkriptionsnivå

Därefter undersökte vi hur XAB2 kan reglera CENPE-uttryck. XAB2 rapporterades tidigare att interagera med RNA-polymeras II och spelar en roll i transkription, 1, 6 vidare observerade vi att utarmning av XAB2 ledde till nedreglering av CENPE på mRNA-nivå i denna studie, vilket tyder på att XAB2 kan transkriptionellt reglera uttrycket av CENPE. För att testa detta konstruerade vi först en luciferasreporter som sträckte sig över en 1355 bp-region från −1263 till +92 av transkriptionsstartplatsen för CENPE. Såsom visas i figur 6a kan detta område driva transkriptionen av luciferas, vilket tyder på att det tjänade som CENPE-promotor. Överuttryck av XAB2 ökade CENPE-promotoraktiviteten med 1, 8-faldig (figur 6a), medan nedslagning av CENPE resulterade i en slående minskning av luciferasaktiviteten med 7, 2-faldig (figur 6b). Överuttrycket och knockdown-effektiviteten för XAB2 bekräftades genom Western blot-analys (figur 6c).

XAB2 reglerar CENPE-uttryck på transkriptionell nivå. ( a ) Luciferasanalys avslöjar att XAB2-överuttryck ökar CENPE-promotoraktiviteten. Cntl: kontroll, OE: överuttryck ( n = 3); * P 0.05. ( b ) Luciferasanalys som visar XAB2-knockdown minskar CENPE-promotoraktiviteten. ( n = 3); *** P 0.001. ( c ) Western blot visar överuttrycket och knockdown-effektiviteten för XAB2. ( d ) Luciferasanalys av seriella borttagningskonstruktioner av CENPE-promotor leder till identifiering av kärnregionen för CENPE-promotor. ( e ) Effekt av XAB2-knockdown på borttagningskonstruktioner av CENPE-promotor genom luciferasanalys ( n = 3); ns, ingen betydelse, * P 0.05, ** P 0.01, *** P 0.001. ( f ) ChIP-analys visar att XAB2 interagerar med CENPE-promotor

Bild i full storlek

För att identifiera den minimala regionen i CENPE-promotor som krävs för XAB2-reglering genererade vi en serie raderingskonstruktioner. Transfektion av dessa konstruktioner till HeLa-celler indikerade att regionen −208/92 visade en luciferasaktivitet nära promotorn i full längd (figur 6d). Dessutom hade regionen −1263 / −209 ingen promotoraktivitet (figur 6d), vilket tyder på att kärnpromotorn sträcker sig över 300 bp från −208 till 92. Transfektion av borttagningskonstruktionerna följt av XAB2-nedslag avslöjade att XAB2-utarmning resulterade i slående minskning i luciferasaktivitet för promotorn i full längd −1263/92, eller borttagningskonstruktioner −808/92 och −408/92, medan ytterligare radering −208/92 ledde till mycket mindre minskning och minskningen avskaffades för konstruktionen −58/92 (figur 6e), vilket antyder att regionen mellan −408 / −59 är kritisk för transkriptionell reglering av CENPE-uttryck med XAB2. Kromatinimmunutfällning (ChIP) av HA-märkt XAB2-protein avslöjade också signifikant anrikning av XAB2 vid CENPE-promotor (figur 6f). Sammantaget stöder dessa data att XAB2 transkriptionellt reglerar uttrycket av CENPE.

Diskussion

XAB2 är en komponent i Prp19-komplexet, det har rapporterats fungera vid transkriptionskopplad DNA-reparation, pre-mRNA-skarvning, mRNA-export, transkription och homolog rekombination. I denna studie rapporterade vi en ny funktion av XAB2 som mitotisk cellcykelregulator.

För att få djup insikt om effekterna av XAB2-brist utförde vi mikroarray-analys på genuttryck efter XAB2-utarmning i HeLa-celler. Överraskande visade denna analys att uttrycket för många gener som fungerar i cellcykel eller mitosreglering förändrades avsevärt. Vi visade vidare att XAB2-brist inducerade kromosomfällning och missreglering, onormal kärnstruktur, spindelpol och mikrotubulär organisation, vilket resulterade i mitotisk arrestering, mitotisk katastrof och efterföljande celldöd, vilket indikerar en kritisk roll för XAB2 i regleringen av mitotisk cellcykel. Våra resultat överensstämmer med fenotyper av XAB2-knockdown som dokumenterats i MITOCHECK-databasen (www.mitocheck.org), inklusive metafasfördröjning, problem med metafasanpassning och celldöd. 25

För att förstå hur XAB2 påverkar mitotisk cellcykel, visade sig CENPE vara bland de bästa generna med en slående minskning av uttrycket efter knockdown av XAB2. CENPE är ett plusändriktat kinetokore-motorprotein som tillhör kinesin-7-underfamiljen och har studerats omfattande. Det rekryteras först vid kinetokore under prometafas beroende på proteiner såsom BubR1, 26 CENPF, 26 NUF2, 27 SEPT7, 28 TRAMM 29 och CTCF, 30 och nedbryts sedan av APC / C och SCF i slutet av mitos. 31, 32 CENPE är ett mycket stort protein omkring 312 kDa med flera funktionsdomäner, inklusive en N-terminal ATP-beroende motordomän, en spole-spole-domän, en C-terminal kinetokor-bindande domän och en C-terminal mikrotubulbindande domän. 26, 30 Tidigare arbete har föreslagit att CENPE spelar en viktig roll i kromosomöverträdelsen under prometafas, 33, 34, bildandet av stabil bindning mellan spindelmikrotubulor och kinetokorer från prometafas till anafas, 35, 36 och mikrotubulär plus-slutförlängning. 37 Dessutom är CENPE också viktigt för att reglera SAC, troligen genom att modulera BubR1-aktiviteter. 38, 39, 40, 41 Nedreglering av CENPE med användning av olika metoder i olika celltyper och arter leder konsekvent till kromosom-inriktning och efterföljande försenad mitotisk progression. 33, 34, 38, 40, 42, 43, 44 De visar emellertid olika cellskydd, varav vissa orsakar långsiktigt mitotiskt arrest, 40, 42 vissa resulterar i kromosomfelregregering efter en mitotisk fördröjning, 38, 43, 44 och vissa till och med leder till celldöd genom apoptos. 33

Således testade vi möjligheten att XAB2 reglerar mitotisk cellcykel via CENPE. I själva verket ledde XAB2-utarmning till dramatisk minskning av CENPE vid både mRNA- och proteinnivåer. I överensstämmelse med tidigare rapporter resulterade CENPE-uttömning i liknande fenotyper som observerades för XAB2-knockdown, inklusive felinställning av kromosom och mitotisk arrestering. Vidare förändrade CENPE-knockdown följt av XAB2 shRNA-behandling inte G2 / M-arresten orsakad av CENPE. Dessa resultat antydde att XAB2 fungerar uppströms om CENPE och kan reglera progressiv mitotisk cellcykel via CENPE.

Vi visade vidare att XAB2 binder till promotorn av CENPE och reglerar dess expression med hjälp av ChIP och luciferasanalys. Överuttryck av XAB2 ledde till högre luciferasaktivitet medan XAB2-utarmning resulterade i en slående minskning av luciferasaktiviteten. Tidigare rapport visade att XAB2 interagerar med RNA-polymeras II och spelar en roll i transkriptionen, mestadels genom att modulera transkriptionförlängning. 6, 10 Eftersom XAB2-komplex (hAquarius, XAB2, Prp19, CCDC16, hISY1 och PPIE) har rapporterats binda till RNA men inte DNA in vitro och XAB2 innehåller 15 tetratricopeptidupprepade motiv involverade i protein-protein-interaktioner men utan DNA-bindande domäner, är det mycket troligt att XAB2 rekryterades till promotorn av CENPE av andra proteiner.

I CENPE-räddningsförsöket observerade vi emellertid ingen signifikant återställande av cellcykelstopp när CENPE uttrycktes på nytt efter XAB2-utarmning (data visas inte). Spännande, återuttryck av CENPE efter dess egen knockdown i Hela-celler kunde inte vända cellcykelstopp heller (data visas inte). Möjlig förklaring för dessa observationer kan inkludera att överuttrycksnivån inte är tillräckligt hög för att kompensera utarmningen på grund av den höga molekylvikten för CENPE (312 kDa) eller att den fenotyp som induceras av CENPE-brist är allvarlig och irreversibel. Dessutom kan vi inte utesluta möjligheten att effekten av XAB2-utarmning förmedlas av defekter i flera gener, vilket avslöjats genom mikroarray-analys att en delmängd gener involverad i cellcykel och mitotisk progression är nedreglerade.

Mitos är en av de kritiska processerna i cellcykeln för korrekt kromosomsegregation under celldelning. Mitosdysregulering orsakar ofta genominstabilitet eller aneuploidi, leder till mitotisk katastrof och celldöd och är nära förknippad med cancer och många andra sjukdomar. Således har riktning mot mitos föreslagits som en attraktiv terapeutisk strategi för cancerterapi, 45, 46, till exempel, anses CENPE-hämmare som GSK923295, 47 syntelin 48 eller PF2721 49 nu ha antitumöraktivitet. Därför kommer det att vara intressant att undersöka om XAB2 kan fungera som ett nytt antimitotiskt mål för cancerterapi.

Material och metoder

Konstruerar och antikroppar

XAB2-konstruktion köptes från Origen och klonades om i modifierad pcDNA3.1-vektor (Promega, USA) innehållande HA-tagg vid 5'-änden. Ett 1355 bp fragment av 5'-sekvenssekvens som sträckte sig från -1263 till 92 (+1 är transkriptionsstartplatsen) av human CENPE-gen amplifierades med PCR från Hela genomiskt DNA och klonades till pGL3-Basic-vektorn (Promega) vid KpnI / HindIII webbplatser. Deletionskonstruktioner av CENPE-promotor förstärktes från promotorns konstruktion i full längd med användning av kapslade PCR. Sekvenserna för alla konstruktioner bekräftades genom direkt sekvensering. Primersekvenser listas i tilläggstabell 2.

Polyklonal antikropp mot XAB2 (Proteintech, Wuhan, Kina, 1: 800), fosfo-histon H3 (Ser10) (CST, MA, USA, 1: 1000), Cdc2 (CST, 1: 2000), Histone H2A.X (Proteintech, 1: 1000), fosfo-histon H2A.X ( y- H2A.X) (CST, 1: 800), monoklonala antikroppar mot HA-tagg (Covance, MA, USA, 1: 2000), CyclinB1 (CST, 1: 2000), CENPE (Abcam, MA, USA, 1: 1000) och a- tubulin (Sigma, Tyskland, 1: 5000) användes i västra blotting.

Cellkultur och RNA-interferens

HeLa- och 293T-celler var gåvor från Reed Lab i Harvard Medical School, MDA-MB-231 celler köptes från American Type Culture Collection (Manassas, VA, USA). Alla celler odlades i dulbeccos modifierade örnmedium kompletterat med 10% fetalt bovint serum.

För siRNA-medierad genutsläppning pläterades celler i en sexbrunnsplatta och 2 mikroliter siRNA vid 50 mikrometer transfekterades med användning av Lipofectamine 3000. Celler behandlades med CENPE siRNA eller XAB2 siRNA för analys 24 respektive 55 timmar efter transfektion. CENPE siRNA och XAB2 siRNA rapporterades tidigare, 22, 50 icke-mål siRNA (RiboBio, Kina) användes som negativ kontroll. SiRNA-sekvenserna är som följer: CENPE siRNA (5'-CCACUAGAGUUGAAAGAUAdTdT-3 '), XAB2-siRNA-1 (5'-CCAAUUCUCUGUCAAAUGCdTdT-3'), XAB2-siRNA-2 (5'-ACUCUA)

För shRNA-medierad genutsläppning producerades lentivirus som uttryckte XAB2-shRNA enligt följande: 293T-celler placerades i 6 cm skål och cotransfekterades med 1, 4 μg XAB2-shRNA (klonad i PLKO.1), 1, 4 μg pREV, 1, 4 μg av pGag / Pol / PRE och 0, 7 μg pVSVG. För kontroll, byt ut XAB2 shRNA-konstruktion med kontrollvektor. Sex timmar efter transfektion ersattes blandningen av färskt dulbeccos modifierade örnmedium innehållande 10% FBS och celler odlades under ytterligare 48 timmar. Sedan filtrerades mediet som innehöll lentivirus och lagrades vid -80 ° C. När det gäller lentivirusinfektion infekterades celler som odlades i en sexbrunnsplatta två gånger med lentivirus innehållande 6 μg / ml polybren under totalt 48 timmar. För mikroarray, Western blot, immunofluorescens, RT-PCR och cellcykeldistribueringsanalys skördades celler efter odling i färskt medium under ytterligare 24 timmar. För celldödanalys skördades celler 48 timmar senare. The full sequence of XAB2 shRNA-1 and XAB2 shRNA-2 are CCGGGCTTCGCTACATCGAGTTCAACTCGAGTTGAACTCGATGTAGCGAAGCTTTTTG and CCGGGCAGTATGACATGTTCAACATCTCGAGATGTTGAACATGTCATACTGCTTTTTG, respectively. XAB2 shRNA-1 was used in the XAB2 knockdown experiments in this study unless otherwise indicated.

Microarray gene expression analysis

Hela cells were plated in six-well plate and infected twice with control or XAB2 shRNA lentivirus. Then cells were harvested and total RNA was isolated using RNeasy plus kit (Qiagen, Germany) following the manufacturer's instruction. The integrity of total RNA was monitored with Agilent 2100 Bioanalyzer. Microarrays were performed using Human Transcriptome Array 2.0 (Affymetrix, USA) with three independent experiments. Results were analysed by using the Transcriptome Analysis Console from Affymetrix. Only genes that had a 2-fold increase or decrease in expression with a significance of P <0.05 were included in the final results. Functional analysis of the genes with expression significantly changed by XAB2 knockdown was performed using Gene Ontology analysis.

FACS analysis

To examine the cell cycle distribution, cells were harvested and fixed in 75% ethanol at 4 °C overnight, washed twice with PBS, and then incubated with PI (Sigma) solution containing RNase for 30 min. The flow cytometry analysis was conducted on ACCURIC6, and the data were analysed using FlowJo7.6 software.

For cell death analysis, cells were stained using annexin/PI staining kit (KeyGEN BioTECH, Nanjing, China) for detection according to the manufacturer's instructions.

To detect the fraction of phospho-Histone H3 Ser10 positive cells, cells were fixed by 75% ethanol, permeabilized by 0.25% Triton X-100, and then stained with Alexa Fluor488-conjugated phospho-Histone H3 Ser10 antibody (1:50, CST) and PI.

immunofluorescens

Cells were grown in 35 mm cell culture dish with glass bottom (NEST, Wuxi, China), fixed with 4% paraformaldehyde (Sigma, Germany) for 30 min, followed by permeabilization with 0.5% Triton X-100 for 10 min at room temperature. Cells were then incubated with α -tubulin antibody (1:250) diluted in PBS with 10% calf serum at 4 °C overnight, and immunostained with Alexa 488-labeled anti-mouse antibody (1:500) diluted in the same buffer at room temperature for 30 min, followed by DAPI staining and four washes with PBS for 5 min each. Fluorescence was detected using DMI6000 microscope (Leica, Germany).

Live cell imaging

GFP-H2B HeLa cells were a gift from Dr Huiyan Li in China National Center of Biomedical Analysis and were placed in 35 mm cell culture dish with glass bottom (NEST). Twenty-four hours after second infection with control or XAB2 shRNA lentivirus, images were captured every 10 min for 48 h using DMI6000 microscope (Leica) equipped with a × 40 objective lens in a chamber maintained at 37 °C with 5% CO 2 .

Transfection and luciferase assay

Cells were seeded into 12-well plate the day before transfection. 1 μg of firefly luciferase constructs were transfected using lipofectamine 2000. The pRL-TK plasmid (100 ng/sample) encoding Renilla luciferase was cotransfected, and the readout was used for normalization of firefly luciferase activity. Cells were harvested 24 h after transfection and luciferase activity was measured with Dual-Luciferase Reporter Assay Kit (Promega). All transfections were performed in triplicate.

To assess the effect of XAB2 overexpression or knockdown on CENPE promoter activity, Hela cells in 12-well plates were transfected with XAB2 construct for 24 h or infected twice with lentivirus containing XAB2 shRNA, followed by co-transfection of CENPE promoter construct and pRL-TK vector, cells were then harvested after 24 h for the measurement of luciferase activity.

ChIP

The ChIP assay was performed using EpiQuik Chromatin Immunoprecipitation Kit from Epigentek Group Inc. (Brooklyn, NY, USA) according to the manufacturer's protocol. Protein-DNA complexes were immunoprecipitated with HA antibody, and normal mouse IgG was used as negative control. Primer sets for CENPE were shown in Supplementary Table 2.

Statistik

Data were presented as mean±sd (standard deviation). Statistical analyses between two groups were performed using Student's t -test with statistical significance defined as * P <0.05, ** P <0.01 and *** P <0.001.

Kompletterande information

PDF-filer

  1. 1.

    Kompletterande figur S1

  2. 2.

    Kompletterande figur S2

  3. 3.

    Kompletterande figur S3

  4. 4.

    Kompletterande tabell S1

  5. 5.

    Kompletterande tabell S2

Ordlista

XPA

xeroderma pigmentosum group A

XAB2

XPA-binding protein 2

CSA

Cockayne syndrome group A

ATRA

all-trans retinoic acid

CENPE

centrosome-associated protein E

FACS

fluorescence-activated cell scanner

γ -H2A.X

Phospho-Histone H2A.X

ChIP

chromatin immunoprecipitation

sd

standard deviation

Kompletterande information åtföljer detta dokument på Cell Death and Disease-webbplatsen (//www.nature.com/cddis)