Trombin spjälkar formerna med hög molekylvikt av basisk fibroblasttillväxtfaktor (fgf-2): en ny mekanism för kontroll av fgf-2 och trombinaktivitet | onkogen

Trombin spjälkar formerna med hög molekylvikt av basisk fibroblasttillväxtfaktor (fgf-2): en ny mekanism för kontroll av fgf-2 och trombinaktivitet | onkogen

Anonim

Abstrakt

Fgf-2- genen kodar för låg molekylvikt (LMW, 18 kDa) och högmolekylär (HMW, 22–24 kDa) former som härstammar från alternativ översättning av en enda mRNA och uppvisar olika biologiska funktioner. HMW-fibroblasttillväxtfaktor-2 (FGF-2) hämmar cellmigration och inducerar celltransformation eller tillväxtstopp på ett celltyp- och dosberoende sätt. Omvänt, LMW FGF-2 upregulerar både cellproliferation och migration i de flesta celltyper. Även om transkriptionell och translationell reglering av HMW och LMW FGF-2 har omfattande undersökts, är lite känt om post-translationell kontroll av deras relativa uttryck. Här rapporterar vi att trombin, en nyckelkoagulationsfaktor och inflammatorisk mediator, klyver HMW FGF-2 i en LMW FGF-2-liknande form som stimulerar endotelcellmigration och -proliferation. Effekten av trombin på dessa cellfunktioner kräver klyvning av HMW FGF-2. Denna post-translationella kontrollmekanism lägger till en ny nivå av komplexitet till regleringen av FGF-2 och kopplar aktiviteterna till trombin och FGF-2 i patofysiologiska processer där båda molekylerna uttrycks.

Introduktion

Grundläggande fibroblasttillväxtfaktor (FGF-2) är den prototypiska medlemmen i en växande familj av små proteiner (Itoh och Ornitz, 2004). Hos människor genereras åtminstone fyra olika molekylviktsformer av FGF-2 från alternativ översättning av ett enda mRNA-transkript. Översättning av 18 kDa-formen, eller låg molekylvikt (LMW) FGF-2, initieras från ett AUG-kodon. Översättning av formerna 22, 22, 5 och 24 kDa, känd som FGF-2 med hög molekylvikt (HMW), initieras från CUG-kodoner uppströms om AUG (Florkiewicz och Sommer, 1989; Prats et al., 1989; Vagner et al., 1995). HMW-formerna av FGF-2 är därför kolinära förlängningar av 18 kDa FGF-2 (Sorensen et al., 2006; Yu et al., 2007). Post-translationell metylering av argininrester i den RG-rika N-terminala änden kontrollerar kärnansamling av HMW FGF-2 (Burgess et al., 1991; Pintucci et al., 1996; Klein et al., 2000). Därför är HMW FGF-2-former övervägande kärn- och nukleolära, medan LMW FGF-2 mestadels är cytoplasmisk. Alla FGF-2-former saknar en konventionell signalpeptidsekvens för utsöndring. Alla frisätts emellertid från celler efter dödlig eller sublethal skada (Yu et al., 2007) eller av andra mekanismer (Mignatti et al., 1991; Piotrowicz et al., 1997; Taverna et al., 2003). HMW och LMW FGF-2 inducerar uttryck av olika gener, vilket genererar unika fenotyper (Quarto et al., 2005). Överuttryck av HMW och LMW FGF-2 främjar celltransformation. Emellertid är ökad cellmigration och förändringar i integrinmönster specifika för LMW FGF-2 och medieras genom receptortyrosinkinas (er) (Klein et al., 1996). Däremot ökar selektivt uttryck av HMW-former inte cellmigreringen och resulterar i celltransformation genom en receptor-tyrosinkinas-oberoende mekanism (er) (Bikfalvi et al., 1995).

Den relativa mängden FGF-2-former skiljer sig mellan celltyper och utvecklingsstadier (Yu et al., 2007). Dessutom induceras selektivt uttryck av HMW FGF-2 av stressbetingelser såsom värmechock och oxidativ stress, cytokiner och tillväxtfaktorer (Yu et al., 2007). De olika FGF-2-formerna har implicerats vid olika patologiska tillstånd, inklusive vaskulär ombyggnad och restenos, neuronal regenerering efter skada och tumörtillväxt. Selektivt överuttryck av HMW FGF-2 korrelerar med dålig prognos i maligniteter såsom nervtumörer, prostatacancer, hypofyseadenom och cancer i bukspottkörteln (Yu et al., 2007). Translationsreglering genom föredragen användning av alternativa startkodoner betraktas som den huvudsakliga kontrollmekanismen för expression av de olika FGF-2-formerna (Touriol et al., 2003). Det är emellertid lite känt om potentiella kontrollmekanismer efter översättningen.

Trombin är en nyckelregulator för vaskulär integritet och homeostas och fungerar som en koagulationsfaktor, angiogen faktor, inflammatorisk mediator, blodplättagonist och regulator för vaskulära cellfunktioner (Mann, 2003). Generering av trombin genom aktivering av den vävnadsfaktorberoende koaguleringskaskaden beskrivs väl i malignitet (Rickles et al., 2003). Trombin har visat sig främja tumörtillväxt och metastaser. Denna effekt har delvis tillskrivits dess angiogena aktivitet (Even-Ram et al., 1998; Tsopanoglou och Maragoudakis, 1999) och effekterna av kemokiner, tillväxtfaktorer och extracellulära proteiner inducerade av trombin (Daniel et al., 1986; Papadimitriou et al., 1997). De flesta trombineffekter har tillskrivits aktivering av specifika proteasaktiverade receptorer (PAR) och nedströms intracellulär signalering (Coughlin, 2005). Här visar vi att trombin också inducerar sina mitogena och migrerande effekter genom klyvning av HMW FGF-2 för att generera en tidigare oidentifierad FGF-2-form innehållande en kort N-terminal förlängning av LMW FGF-2. Denna nya FGF-2-form förmedlar den migrerande och proliferativa effekten av trombin på endotelceller.

Resultat

Trombin klyver HMW FGF-2

Vid undersökning av vaskulära svar på arterialisering av ventransplantat fann vi en dramatisk och snabb ökning av blodtrombinativt associerad trombinaktivitet (Sharony et al., 2006). Eftersom denna effekt parallelliserades av en uppenbar ökning i LMW FGF-2 och försvinnande av HMW FGF-2 i ventransplantaten, antagde vi att trombin klyver HMW FGF-2 i LMW-former i vaskulära celler. Därför karakteriserade vi effekten av trombin på FGF-2-former i endotelcellkulturer. Tillsats av trombin till odlingsmediet resulterade i förlust av cellassocierad HMW FGF-2 och samtidig ackumulering av LMW FGF-2 (figur la). Denna effekt inträffade inom 5 minuter efter trombinbehandlingen, vilket indikerade att den inte resulterade från en translationell mekanism. I överensstämmelse med detta konstaterande resulterade trombinbehandling av murina FGF-2 - / - endotelceller som är transfekterade med humant HMW FGF-2 (FGF 365 ) snabbt försvinnande av HMW FGF-2 och generering av en FGF-2-form som samvandrade med LMW FGF-2 i polyakrylamidgelelektrofores (figur la).

Trombin genererar en LMW-liknande FGF-2 genom proteolys av HMW FGF-2. ( a ) Immunoblottinganalys av FGF-2 i otransfekterad BCE och i FGF-2 - / - endotelceller som transfekterats transient med humant HMW FGF-2 (FGF 365 ) och behandlat med trombin (1, 5 U ml-1) under 5 minuter. ( b ) FGF-2-uttryck och ERK-1/2-aktivering (pERK-1/2) i BCE-celler behandlade med antingen TRAP (50 μmol 1) eller trombin (1, 5 U ml −1 ) under de angivna tiderna. ERK-2 visas som en lastkontroll. ( c ) FGF-2-klyvning i BCE-celler behandlade med trombin (1, 5 U ml-1) under 5 minuter efter 1 min förinkubation med hirudin eller Pefabloc. ( d ) Immunoblottinganalys av heparin-Sepharose-renat HMW FGF-2 inkuberat med kontrollmedium eller trombin (1, 5 U ml-1) under 5 minuter. ( e ) Immunoblotting-analys av HMW FGF-2 i medium konditionerat av BCE (övre panel) eller FGF 365- celler (nedre panel) behandlade med trombin (1, 5 U ml-1) under 5 minuter. 1, kontrollmedium; 2; kontrollmedium kompletterat med human rekombinant FGF-2 (10 ng ml-1) under 5 minuter; 3, kontrollmedium plus trombin; 4, H202 (400 μM) behandling under 6 timmar; spår 5, H202 (400 mikrometer) behandling under 6 timmar följt av trombinbehandling. Konditionerade media koncentrerades affinitet med heparin-Sepharose före immunblotting med anti-FGF-2-antikropp. Varje experiment upprepades minst tre gånger med jämförbara resultat. LMW, låg molekylvikt; FGF-2, fibroblasttillväxtfaktor-2; HMW, hög molekylvikt; ERK-1/2, extracellulär-signalreglerad kinas-1/2; TRAP, trombinreceptoragonistpeptid.

Bild i full storlek

För att bestämma om generering av LMW FGF-2 genom trombin är beroende av aktivering av trombinreceptorn, behandlade vi BCE-celler med trombinreceptoragonistpeptiden (TRAP). Som förväntat (Rauch et al., 2005) inducerade TRAP kortvarig aktivering av extracellulärt signalreglerat kinas (ERK) -1/2 men ändrade inte de relativa nivåerna av HMW och LMW FGF-2 (figur Ib). I överensstämmelse med tidigare rapporter (Rauch et al., 2004) ökade emellertid TRAP FGF-2-uttrycket vid senare tidpunkter. Omvänt resulterade trombinbehandling i förlust av HMW FGF-2 och ackumulering av LMW FGF-2 (figur Ib). Dessa resultat indikerade att den snabba ansamlingen av LMW FGF-2 inducerad av trombin resulterar från proteolytisk klyvning av HMW FGF-2 och är oberoende av trombinreceptoraktivering. Denna effekt inhiberades verkligen av både serinproteasinhibitorn Pefabloc och den trombinspecifika hämmaren hirudin (figur 1c). Vi kommer att hänvisa till denna klyvningsprodukt av FGF-2 som ELF-2 (arton kDa-liknande FGF-2) för att skilja den från 18 kDa FGF-2.

För att utesluta möjligheten att trombin verkar på HMW FGF-2 indirekt genom en cellberoende mekanism, renade vi HMW FGF-2 genom heparinaffinitet följt av inkubation med trombin vid 37 ° C. Trombin klyvdes snabbt renat HMW FGF-2 (figur 1d), vilket visar att ELF-2 genereras direkt av trombin och inte genom signalering av händelser sekundära till trombininteraktion med PAR.

Både LMW och HMW FGF-2 frisätts från celler av ett antal mekanismer, bland vilka skada är en viktig en (Yu et al., 2007). Därför utsatte vi endotelceller för sublethal skada genom exponering för oxidativ stress med 400 μmol l1 av H202 eller genom transient transfektion med HMW FGF-2 komplementärt DNA (cDNA). Immunblotting av det cellkonditionerade mediet under endera behandlingen visade att alla former av FGF-2 frisattes från cellerna, och att trombinbehandling resulterade i extracellulär proteolys av HMW FGF-2 (figur 1e). Dessa experiment indikerade också att ELF-2 är den ultimata C-terminala produkten av HMW FGF-2-proteolys med trombin. I överensstämmelse med tidigare rapporter (Lobb, 1988) fann vi också att trombin inte klyver 18 kDa FGF-2 (kompletterande figur 1).

Identifiering av trombinklyvningsställen på HMW FGF-2

ELF-2 uppvisade en något lägre elektroforetisk rörlighet än 18 kDa FGF-2 (figur la), vilket antyder att trombinspjälkningsstället är beläget uppströms om den N-terminala initiatormetionin av LMW FGF-2. Jämförelse av den N-terminala sekvensen av HMW FGF-2 med kända konsensussekvenser för trombinklyvning indikerade tre förmodade ställen (figur 2). Vi genererade därför FGF-2-mutanter innehållande alanin (A) -substitutioner av argininerna (R) vid förmodade klyvningsställen (figur 2; FGF- mut-7, FGF- mut-10, FGF- mut-16 och kombinationer därav). Dessa mutationer genererades i ett humant HMW FGF-2 cDNA som innehåller en punktmutation i AUG-startkodonet som förhindrar translation av 18 kDa FGF-2 (FGF 365 ). Därför kan LMW FGF-2 detekterad vid trombinbehandling endast härröra från klyvning av HMW FGF-2. FGF-2 - / - endotelceller transfekterade med antingen FGF 365 eller mutant cDNA behandlades med trombin, och FGF-2-uttryck analyserades genom immunblotting. Enstaka mutationer av någon av de tre förmodade klyvningsställena gav inte resistens mot trombinklyvning. Trombinklyvning av FGF-2 avskaffades emellertid i dubbel- eller trippelmutanter (figur 3). Den dubbla mutanta FGF- mutten 10 / mut-7 klyvdes av trombin. Dessa resultat indikerade att alla tre R-resterna tjänar som platser för trombinklyvning, och att mutation av R-16 är nödvändig men inte tillräcklig för att avskaffa trombinklyvning.

Aminosyrasekvens uppströms initiatormetionin (M) på 18 kDa FGF-2. Sekvenserna för vikt FGF-2 (FGF vikt ) och HMW FGF-2 (FGF 365 ) är i linje med dem från R till A-mutanter. Mutationsresterna är med fetstil och indikeras med en asterisk ( * ). FGF, fibroblasttillväxtfaktor; HMW, hög molekylvikt.

Bild i full storlek

Kombinerade dubbla eller tredubbla mutationer av trombinklyvningsställen avskaffar HMW FGF-2-klyvning med trombin. Immunblottinganalys av FGF-2-former i extrakt av FGF-2 - / - celler transient transient med cDNA: er av olika FGF-2-klyvningsmutanter och behandlas med trombin under 5 minuter. FGF, fibroblasttillväxtfaktor; HMW, hög molekylvikt; cDNA: er, komplementära DNA: er

Bild i full storlek

Klyvning av HMW FGF-2 förmedlar trombinstimulering av endotelcellmigration och proliferation

Vi har tidigare visat att sårinducerad cellmigration är starkt försämrad i FGF-2 - / - endotelceller (Pintucci et al., 2002). Därför analyserade vi effekten av trombinklyvning av HMW FGF-2 på migrationen av FGF-2 - / - endotelceller stabilt transfekterade med antingen klyvningstillåtande eller -resistenta humana HMW FGF-2. För dessa experiment använde vi 1, 5 U ml -1 trombin, en fysiologisk koncentration (Ishibashi et al., 2003) som effektivt spjälkar HMW FGF-2 (figur 1c och kompletterande figur 2). Trombin främjade migration endast i celler som uttrycker klyvningstillåtande HMW FGF-2, medan exogen 18 kDa FGF-2 hade en pro-migrerande effekt i alla celltransfektanter (figur 4a). Trombininducerad migration avskaffades genom neutralisering av FGF-2-antikropp (figur 4b), vilket visar att den pro-migrerande effekten av trombin medieras av HMW FGF-2-härledda ELF-2.

Trombin stimulerar migration endast i celler som uttrycker klyvningstillåten HMW FGF-2. ( a ) Migrering av FGF-2-transfektanter i närvaro (svarta staplar) eller frånvaro (grå staplar) av 1, 5 U ml −1 trombin under 24 timmar. Liknande resultat erhölls med kloner av stabila transfektanter som uttryckte jämförbara mängder FGF-2. Migrering i närvaro av 10 ng ml-1 FGF-2 (streckade staplar) visar att exogen human rekombinant LMW FGF-2 inducerad cellmigration i alla cellkloner. * P 0, 01 (trombin mot kontroll). ( b ) Migrering av HMW-uttryckande celler (FGF 365 ) behandlade med 1, 5 U ml −1 trombin i närvaro av 40 μg ml −1 av antingen icke-immun IgG eller anti-FGF-2 antikropp. * P 0, 01 (antikropp vs icke-immun IgG). Dessa experiment upprepades minst tre gånger med jämförbara resultat. IgG, immunoglobulin G; FGF, fibroblasttillväxtfaktor; HMW, hög molekylvikt; LMW, låg molekylvikt.

Bild i full storlek

För att karakterisera effekten av trombinklyvning av HMW FGF-2 på endotelcellsproliferation, uppmättes vi bromodeoxyuridin (BrdU) -inkorporering i FGF-2 - / - endotelceller stabilt transfekterade med klyvningspermissiv eller -resistent HMW FGF-2. Trombininducerad cellproliferation i celler transfekterade med klyvningstillåtna FGF-2-mutanter men inte i celler som uttrycker klyvningsresistenta FGF-2 (figur 5a). Som observerats för cellmigrering avskaffades effekten av trombin genom neutralisering av FGF-2-antikropp (figur 5b). Dessa resultat visade att klyvning av HMW FGF-2 förmedlar trombininduktion av endotelcellmigration och proliferation.

Trombin stimulerar proliferation endast i celler som uttrycker klyvningstillåten HMW FGF-2. ( a ) BrdU-införlivande i celler som uttrycker klyvningstillstånd eller -resistent HMW FGF-2 behandlad med 1, 5 U ml-1 trombin under 24 timmar. FGF-2 - / - : kontroll, tomma vektortransfekterade celler behandlade med trombin (FGF-2 - / - ). Detta experiment upprepades med olika kloner av transfekterade celler som uttrycker jämförbara mängder FGF-2 med liknande resultat. * P <0, 01 vs kontroll. ( b ) BrdU-införlivande i HMW-uttryckande celler (FGF 365 ) och FGF-2 - / - celler behandlade med trombin i närvaro av antingen 40 μg ml −1 icke-immun IgG eller anti-FGF-2 antikropp. * P 0, 05 (antikropp vs icke-immun IgG). Dessa experiment upprepades minst tre gånger med jämförbara resultat. FGF, fibroblasttillväxtfaktor; HMW, hög molekylvikt; LMW, låg molekylvikt; IgG, immunoglobulin G; BrdU, bromodeoxyuridin.

Bild i full storlek

Signalering genererad av trombin genom PAR-1-aktivering kontrollerar endotelcellmigration och -proliferation (Coughlin, 2005). Därför är det möjligt att medan klyvning av HMW FGF-2 krävs för trombinstimulering av endotelcellproliferation och migration, kan ELF-2 behöva synergisera med trombin-signalering för att stimulera dessa cellfunktioner. För att undersöka denna möjlighet kännetecknade vi först uttrycksprofilen för PAR i våra murina endotelcelltransfektanter som uttrycker humana HMW FGF-2 (365 celler). I överensstämmelse med tidigare rapporter (O'Brien et al., 2000) fann vi att PAR-1 uttrycks i dessa celler (kompletterande figur 3), medan PAR-3, en receptor med lägre affinitet för trombin än PAR-1, är dåligt uttryckt och PAR-4 uttryck är försumbar. Endast PAR-2, en receptor specifik för flera trypsinliknande serinproteaser men inte för trombin, uttrycks i jämförbara nivåer som PAR-1 i våra celler. Övergående transfektion med PAR-1 liten interfererande RNA (siRNA) resulterade i stark nedreglering av PAR-1-uttryck (figur 6a) men påverkade inte trombininduktion av cellmigration och proliferation (figur 6b och c) även om det avskaffade TRAP-inducerad ERK- 1/2 signalering (kompletterande figur 4). Således krävs trombin-klyvning av HMW FGF-2 och generering av ELF-2 inte bara utan också tillräckligt för att utlösa endotelcellmigration och proliferation utan samtidig signalering medierad genom PAR-1-aktivering.

Nedreglering av PAR-1-uttryck påverkar inte trombinstimulering av migration och proliferation i endotelceller som uttrycker HMW FGF-2. ( a ) Omvänd transkriptas – PCR-analys av PAR-1-uttryck i 365 celler transfekterade med en pool av tre murina PAR1-specifika siRNA (siRNA) eller med siRNA (C). GAPDH cDNA visas som en kontroll. ( b ) Migrering av 365 celler transfekterade med PAR-1 siRNA eller kontroll siRNA och behandlas med trombin (1, 5 U ml-1) eller kontrollmedium. * P <0, 01 vs kontroll. ( c ) Analys av BrdU-upptag i 365 celler transfekterade med PAR-1 siRNA eller kontroll siRNA och inkuberades i närvaro eller frånvaro av trombin (1, 5 U ml-1) under 24 timmar. Barer indikerar en ökning av BrdU-inkorporering i fold i trombinbehandlade celler kontra kontrollceller utan trombin. * P > 0, 05. Dessa experiment upprepades minst tre gånger med jämförbara resultat. PAR-1, proteasaktiverad receptor-1; siRNA, liten störande RNA (siRNA); BrdU, bromodeoxyuridin, GAPDH, glyceraldehyd-3-fosfatdehydrogenas.

Bild i full storlek

Diskussion

De presenterade uppgifterna visar att trombin klyver HMW FGF-2, som hämmar cellmigration och proliferation, för att generera en LMW FGF-2-liknande produkt (ELF-2) som stimulerar dessa cellfunktioner. Trombin främjar cellproliferation och migration genom en mekanism delvis förmedlad genom autokrin produktion av FGF-2 (Herbert et al., 1994; Cucina et al., 2002; Rauch et al., 2004) som ett resultat av transkriptionella och translationella mekanismer sekundära till PAR-aktivering. Trombin-klyvningen av HMW FGF-2 som vi beskrev representerar en snabb mekanism för post-translationell kontroll av FGF-2-aktivitet oberoende av PAR-aktivering. Denna slutsats stöds av vår observation att TRAP, en peptidagonist av trombinreceptor, varken minskar HMW eller ökar LMW FGF-2-uttrycket. FGF-2 - / - endotelcellerna som användes i vår studie uttrycker trombinreceptorer PAR-1 till -3, i överensstämmelse med tidigare fynd i endotelceller från mänskliga navlarna (O'Brien et al., 2000; Kompletterande figur 3). Vi fann att undertryckning av PAR-1-uttryck genom siRNA-tystnad inte påverkade trombininduktion av cellmigration och proliferation i celler som uttrycker human HMW FGF-2. Eftersom TRAP aktiverar PAR utan den proteolytiska aktiviteten av trombin visar dess oförmåga att generera ELF-2 att genereringen av en LMW-liknande FGF-2 medieras av den proteolytiska aktiviteten av trombin och inte av PAR-aktivering. Därför visar våra resultat att LMW FGF-2-aktivitet kan induceras av trombin av både translation-beroende och -beroende mekanismer.

HMW FGF-2 hämmar cellmigrering (Ding et al., 2002) och inducerar celltransformation eller tillväxtstopp beroende på celltyp och uttrycksnivå (Yu et al., 2007). Våra stabila HMW FGF-2-transfektanter visade konsekvent minskad spridning jämfört med deras FGF-2-noll motsvarighet (data visas inte). Således representerar klyvning av HMW FGF-2 till ELF-2, en molekyl med biologisk aktivitet liknande den för 18 kDa FGF-2, en anmärkningsvärd mekanism för att byta en prekursormolekyl med hämmande aktivitet till en proliferativ och pro-migrerande tillväxtfaktor ( Figur 7).

Effekt av trombinklyvning på human HMW FGF-2-aktivitet. Den mänskliga fgf-2- genen kodar fyra huvudformer av FGF-2 (24, 22, 5 och 22 kDa, eller HMW FGF-2 och 18 kDa FGF-2 eller LMW FGF-2) som härstammar från ett unikt mRNA (början av varje form indikeras med en tunn pil). HMW FGF-2 frisätts från cellen efter cell- eller vävnadsskada, tillstånd som också leder till trombinbildning. Trombin klyver alla HMW FGF-2-former till en LMW FGF-2-liknande form (ELF-2) som stimulerar cellmigration och spridning. FGF, fibroblasttillväxtfaktor; HMW, hög molekylvikt; LMW, låg molekylvikt.

Bild i full storlek

Trombin klyver tau, ett intracellulärt protein implicerat vid neurodegenerativ sjukdom (Arai et al., 2005), vilket antyder att det kan klyva intracellulära proteiner. Omvänt inträffar trombin-klyvning av HMW FGF-2 troligt vid cellytan och / eller i den extracellulära miljön. I själva verket, även om vi inte kan utesluta möjligheten att HMW FGF-2-klyvning som observerats i celllysat inträffar vid cellytan och eventuellt är klar under celllys, inträffar dess mest relevanta klyvning troligen i den extracellulära miljön, där HMW FGF-2 massivt frisatt vid skada (Yu et al., 2007) (figur 1). I själva verket exporteras både LMW och HMW FGF-2 från cellen genom alternativa, endoplasmiska retikulum-Golgi-oberoende vägar och frigörs vid celldöd, sår eller sublethal cellskada (Yu et al., 2007). Vi visade att frisättning av alla former av FGF-2 sker i skadade endotelceller, till exempel under oxidativ stress. Denna upptäckt har fysiopatologiska konsekvenser eftersom endotelskada ofta inträffar samtidigt med trombinbildning i den vaskulära bädden, vilket möjliggör trombin-HMW FGF-2-interaktion i den extracellulära miljön. Det återstår att bestämma om andra serinproteinaser involverade i inflammation också kan klyva HMW FGF-2 med en effekt som liknar den för trombin.

FGF-2-aktivitet kontrolleras på flera nivåer inklusive gentranskription och selektiv translation av HMW- eller LMW-former (Sorensen et al., 2006; Yu et al., 2007). Nyligen har en 16 kDa-form som har sitt ursprung genom proteolys av 18 kDa FGF-2 beskrivits (Malecki et al., 2004). Men i överensstämmelse med tidigare rapporter (Lobb, 1988) fann vi att trombin inte klyver 18 kDa FGF-2 (kompletterande figur 1); därför är ELF-2 den ultimata produkten av HMW FGF-2-proteolys med trombin.

FGF-2, en allestädes närvarande tillväxtfaktor, har varit inblandad i olika fysiologiska och patologiska processer inklusive tumörtillväxt, benombyggnad, angiogenes, sårläkning och vaskulär ombyggnad (Ornitz och Itoh, 2001; Yu et al., 2007). Trombin har också visats vara involverat i många av samma processer, särskilt i kardiovaskulära och neoplastiska tillstånd. Dessutom har proteolytiska aktiviteter inklusive trombin beskrivits i områden där HMW FGF-2-uttryck är särskilt förhöjda, såsom i hjärnan (Claus et al., 2004; Arai et al., 2005). Därför kan trombinklyvning av HMW FGF-2 involveras i en mängd olika fysiopatologiska inställningar och representera en mekanism för kontroll av både FGF-2 och trombinaktiviteter.

Material och metoder

Reagens och antikroppar

Human rekombinant FGF-2 köptes från Gibco BRL, Life Technologies, Inc. (Rockville, MD, USA). Anti-human FGF-2 monoklonal antikropp (354FI) var en generös gåva från Texas Bio-Technologies (Houston, TX, USA). Nötkreatur och humant trombin köptes från Calbiochem (La Jolla, CA, USA) respektive Sigma-Aldrich (Saint Louis, MO, USA). TRAP var från Bachem Bioscience, Inc. (King of Prussia, PA, USA), fosfo-ERK-1/2-antikropp från Cell Signaling Technologies (Beverly, MA, USA) och ERK-2-antikropp från Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Celler och kulturförhållanden

Media och serum var från Mediatech, Inc. (Herndon, VA, USA). Murine FGF-2 - / - och bovina kapillärendotelceller (BCE; Cell Applications, San Diego, CA, USA) odlades som beskrivits (Pintucci et al., 2002). NIH 3T3-celler som uttrycker human HMW eller LMW FGF-2 var en generös gåva från Dr Daniel B Rifkin (NYU School of Medicine) och har beskrivits (Bikfalvi et al., 1995).

Mutation av klyvningsplatser

Humant HMW FGF-2 cDNA med en punktmutation i 365 basparets startkodon (en gåva från Dr Natalina Quarto, Stanford University, CA, USA) klonades i pcDNA 3.1 (+) (FGF 365 Rev ). Alla mutationer genererades genom PCR med användning av ThermalAce DNA Polymerase (Invitrogen, Carlsbad, CA, USA) med en glödgningstemperatur av 56 ° C, och sekvensen för bovint tillväxthormon polyadenyleringssignal som omvänd primer: 5'-TAGAAGGCACAGTCGAGGCTGAT-3 ' . Arginin till alanin-mutationer genererades med användning av FGF 365 Rev- plasmid som en mall och följande framåtriktade primrar (de muterade kodonerna har fetstil). Enstaka mutanter : FGF mut-16 Rev 5′-CCCTGCGGGGCCCGGCCGGGATCCCCGAGCCGCTGGAGCCGC GGC GGGAGCCGC-3 ′; FGF mut-10 Rev CCCTGCGGGGCCCGGCCGGGATCC CGC AGCCGCTGGAGCCGCGCGGGGAGCCGC-3 ′; FGF mut-7 Rev 5′-CCCTGCGGGGCCCGG CGC GGATCCCCGAGCCGCTGGAGCCGCGCGGGGAGCCGC-3 ′; dubbla mutanter : FGF mut-10 / -7 Rev 5'-GGTCCCTGCGGGGCCCGG CGC GGAT-3 ', mall FGF mut-10 Rev ; FGF mut-16 / -7 Rev 5'-GGTCCCTGCGGGGCCCGG CGC GGAT-3 ', mall FGF mut-16 Rev ; FGF mut-16 / -10 Rev 5′-CCCTGCGGGGCCCGGCCGGGATCC CGC AGCCGCTGG-3 ′, mall FGF mut-16 Rev ; trippelmutant : 5'-CCCTGCGGGGCCCGG CGC GGATCC CGC AGCCGC-3 ', mall FGF mut-16 / -10 Rev. PCR-produkterna digererades med Apa1 (New England Biolabs, Ipswich, MA, USA) och klonades in på Apa1-stället i FGF 365 Rev. Plasmiderna digererades med EcoRI (New England Biolabs) för skärning av det muterade FGF-2 cDNA, som klonades tillbaka i rätt orientering i både pcDNA 3.1 (+) och pcDNA 3.1 / zeo (+) (Invitrogen). Mutanterna kännetecknades av DNA-sekvensering med Applied Biosystems 3730 DNA Analyzer (Applied Biosystems, Foster City, CA, USA).

transfektion

FGF-2 - / - endotelceller vid 40% sammanflytning transfekterades med 4 μg human wt eller mutant HMW FGF-2 cDNA och 12 μl Lipofectamine 2000 (Invitrogen). Mediet ersattes med färskt a-MEM innehållande 10% fetalt kalvserum 6 timmar efter transfektion.

Immortalisering av FGF-2 - / - celler

Primära FGF-2 - / - endotelceller immortaliserades genom retroviral transduktion med humant telomeras. Viruset genererades i det 293 derivat-paketet Cell-Eco-paket (en gåva från Dr Garry Nolan, Stanford University och Dr Susan Smith, NYU School of Medicine) såsom beskrivits (Counter et al., 1998).

Generering av stabila transfektanter

Immortaliserade FGF-2 - / - endotelceller transfekterades med Lipofectamine 2000 och human wt (FGF 365 ) eller mutant HMW FGF-2 cDNA i pcDNA 3.1 / zeo. (+). Efter 48 timmar efter transfektion placerades cellerna i medium innehållande 2 mg ml-1 zeocin (Invitrogen). Resistenta kloner screenades för FGF-2-expression genom immunblotting, och kloner med jämförbara nivåer av FGF-2 användes i experimenten.

immunoblotting

Konditionerade media inkuberades med heparin-Sepharose-pärlor (Bio-Rad Laboratories, Hercules, CA, USA) med försiktig gungning vid 4 ° C under 1 timme. Efter centrifugering vid 2000 rpm i 1 min i en Eppendorf-centrifug sattes reducerande provbuffert till pärlorna och laddades på en natriumdodecylsulfat-polyakrylamidgel för elektrofores. Konditionerade medier och cellextrakt analyserades genom immunblotting som beskrivits (Pintucci et al., 2002).

Trombinklyvning av renad HMW FGF-2

Cellextrakt inkuberades med heparin-Sepharose-pärlor (Bio-Rad Laboratories) med försiktig gungning vid 4 ° C under 1 timme. Tvättade pärlor inkuberades sedan med 1, 5 U ml -1 trombin vid 37 ° C under 15 minuter och laddades på natriumdodecylsulfat-polyakrylamidgel för elektroforesgeler för immunblottinganalys.

Omvänd transkriptas – PCR

Totalt RNA isolerades från FGF-2 - / - celler stabilt transfekterade med antingen FGF 365 eller trippelmutanten FGF mut-16 / mut-10 / mut-7 med användning av RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Totalt användes 1 μg RNA för förststrängd cDNA-syntes med SuperScript First-Strand Synthesis System för omvänt transkriptas – PCR (Invitrogen) följt av PCR-amplifiering av PAR 1–4 enligt beskrivningen (Balcaitis et al., 2003).

Cellmigrations- och proliferationsanalyser

Cellmigration och proliferation karakteriserades såsom beskrivits (Pintucci et al., 2002; Ferrari et al., 2006).

siRNA tystnad

FGF 365- celler vid 40% sammanflytning i skålar på 6 cm transfekterades med 100 pmol PAR-1 siRNA eller förvrängd kontroll siRNA (Santa Cruz Biotechnology) med användning av Lipofectamine 2000 (Invitrogen) såsom beskrivits (Ferrari et al., 2006). Såranalys och BrdU-inkorporeringsanalys utfördes 72 timmar efter transfektion som beskrivits (Pintucci et al., 2002; Ferrari et al., 2006). PAR-1-uttryck kännetecknades också av omvänt transkriptas – PCR 72 timmar efter transfektion. Kontrollexperiment för TRAP-inducerad signalering utfördes på serum-svältade celler som inkuberades med eller utan TRAP-1 (H-Ser-Phe-Phe-Leu-Arg-Asn-OH) (100 μM) specifikt för murint PAR-1 ( Bachem Bioscience, Inc) i 15 minuter. Human trombin (1, 5 U ml-1) tillsattes alternativt som en ytterligare kontroll för dessa experiment. Celllysat testades med avseende på ERK-1/2-signalering såsom beskrivits ovan.

Kompletterande information

Bildfiler

  1. 1.

    Kompletterande figur 1

  2. 2.

    Kompletterande figur 2

  3. 3.

    Kompletterande figur 3

  4. 4.

    Kompletterande figur 4

  5. 5.

    Kompletterande figur 5

Word-dokument

  1. 1.

    Kompletterande information

    Kompletterande information åtföljer uppsatsen på Oncogene-webbplatsen (//www.nature.com/onc).