Smedob1 krävs för planarisk homeostas och förnyelse | vetenskapliga rapporter

Smedob1 krävs för planarisk homeostas och förnyelse | vetenskapliga rapporter

Anonim

ämnen

  • Vuxna stamceller
  • Begynnande ålderdom

Abstrakt

Den planära flatmasken är en ny modell som är användbar för att studera homeostas och regenerering på grund av dess unika vuxna stamceller (ASC). Tidigare befanns planaria dela däggdjur TTAGGG kromosomändar och telomeraser; deras telomerskyddsproteiner har emellertid ännu inte identifierats. I Schmidtea mediterranea identifierade vi en homolog för det mänskliga skyddet av telomerer 1 (POT1) med en OB-fold (SmedOB1). SmedOB1 är evolutionsmässigt bevarad bland arter och uttrycks allmänt över hela kroppen. Matning med SmedOB1 dubbelsträngade RNA: er (dsRNA) ledde till homeostasavvikelser i huvudet och svalget. Dessutom nedreglerades flera ASC-avkommamarkörer och regenereringen försämrades. Här fann vi att SmedOB1 krävs för bildning av telomer DNA-proteinkomplex och den associerar med telomeren TTAGGG-sekvens in vitro . Dessutom påverkades DNA-skador och apoptossignaler hos planarian signifikant av SmedOB1 RNAi. Vi bekräftade också dessa fenotyper i Dugesia japonica, en annan planormart. Vårt arbete identifierade ett nytt telomer-associerat protein SmedOB1 i planarian, vilket krävs för planarisk homeostas och regenerering. De fylogenetiska och funktionella konservationerna av SmedOB1 tillhandahåller en mekanism genom vilken planärer upprätthåller telomer- och genomstabilitet för att säkerställa deras odödlighet och belysa människors förnyelsemedicin.

Introduktion

Vuxna stamceller (ASC) självförnyas och ger upphov till flera celltyper under vävnadshomeostas och regenerering 1, 2 . Telomerunderhåll är avgörande för ASC självförnyelse och pluripotency 3, 4 . Telomerer är G-rika tandemupprepningssekvenser i slutet av linjära kromosomer. Bibehållande av telomerlängd och integritet beror på telomeras-holoenzym samt en mängd telomerbindande proteiner 5, 6 . Även om de exakta telomere-DNA-sekvenserna och de specifika involverade telomera proteinerna varierar mellan organismer, är många av de viktigaste telomere-regulatoriska proteinerna evolutionsbesparade. Exempelvis konserveras det ensträngade telomer-DNA (G-strängen) bindande proteinet POT1 från Oxytricha nova (TEBPa) till människor (POT1) 7, 8 . POT1 innehåller oligonukleotid / oligosackaridbindande veck (OB-veck) och uttrycks i stort sett. Radering av Pot1-genen i fissionjäst orsakar snabb förlust av telomer DNA, följt av kromosominstabilitet och celldöd 8 . POT1-homologer i C. elegans, CeOB1 och CeOB2, visade sig binda till G-strängen respektive C-strängens överhäng 9 . Möss har två Pot1-ortologer (Pot1a och Pot1b) med distinkta funktioner i underhåll och skydd av telomer 10 . Human POT1 klonades ursprungligen baserat på sin sekvenshomologi med TEBPa och är kritisk för att säkerställa korrekt telomerlängdskontroll och stabilitet 7, 8 . Intressant nog avskaffade en serie mutationer i POT1 sin DNA-bindningsförmåga, som är relaterad till malignt kutan melanom, och POT1-funktionsförlustmutationer orsakar predisposition för familjärt melanom, vilket antyder att telomere-skyddsfunktionen för POT1 kan säkerställa genomstabilitet och förhindra tumourigenes 11, 12 .

Sötvattenplanarier är välkända för sina anmärkningsvärda regenererande förmågor, där förlorade kroppsdelar regenereras från ASC: er som kallas neoblaster. Att utforska hur telomerreglering bidrar till ASC-underhåll hos plananer bör i hög grad främja vår förståelse av vävnadsregenerering hos människor. Telomer-sekvenserna hos planarianer liknar dem hos däggdjur (TTAGGG) 13, 14 . Dessutom har telomeras identifierats i Schmidtea mediterranea och aktiveras när asexuella planörer delas upp och regenererar 3 . Emellertid förblir i stort sett okända mekanismer genom vilka planörer upprätthåller telomerer och genomstabilitet. De reglerande proteinerna som deltar i telomerskydd och längdkontroll hos plananer har ännu inte identifierats.

Här presenterar vi identifiering och utredning av en däggdjurs POT1-homolog med en bevarad OB-vikning (SmedOB1) i den planära Schmidtea mediterranea . SmedOB1 krävs för vävnadshomeostas och regenerering. Inhibering av SmedOB1-uttryck kan störa självförnyelse av stamceller och orsaka DNA-skador och apoptos. Genom EMSA-analyser med användning av renade proteiner eller endogena nukleära extrakt från planärer bekräftade vi att SmedOB1 krävs för telomer DNA-proteinkomplexförening. Konsekvent ökade förlusten av SmedOB1 signifikant DNA-skadorna såväl som apoptossignaler hos planarian. Vi bekräftade också dessa fenotyper i en annan plattormart, Dugesia japonica . I denna studie identifierade vi ett nytt telomererassocierat SmedOB1-protein som krävs för planmatisk homeostas i sötvatten och regenerering, vilket indikerar att detta telomererassocierade protein är avgörande för planerare att upprätthålla telomerer och genomstabilitet för att säkerställa deras odödlighet.

Resultat

Identifiering av en Schmidtea mediterranea- homolog av human POT1

Planarianer har telomereupprepade sekvenser som liknar de hos människor (TTAGGG) 13, 14 . Med hjälp av prober som innehöll TTAGGG-sekvenser upptäckte vi faktiskt telomerer i metafasspridningar av två arter av planarianer, Schmidtea mediterranea och Dugesia japonica (kompletterande figur S1A, B). Vi använde sedan sekvensen från den längsta isoformen av human POT1 (isoform 1) för att söka i Schmidtea mediterranea- genomdatabasen (//smedgd.stowers.org) och fann att 333-bp-genomsekvensen V31.002347: 3945..3613 var en betydande match. Sedan erhölls med användning av 5 'och 3'RACE PCR ett 1506 bp full-längd cDNA. Vi namngav denna gen SmedOB1 (Fig. 1 A) (Kompletterande Fig. S2A, B).

( A ) Primers baserade på BLAST-resultatet (V31.002347: 3945..3613) användes för 5 "RACE och 3" RACE PCR från SmedOB1. ( B ) Sekvenshomologi för OB1-vikningsdomänen i POT1 eller proteiner som liknar POT1 i människa (H. sapiens POT1), mus (M. musculus POT1a), kyckling (G. gallus POT1), groda (X. laevis POT1), zebrafisk (D. rerio POT1), Schmidtea mediterranea (S. med POT1, dvs SmedOB1), Arabidopsis thaliana (A. thaliana POT1), jäst (S. pombe POT1, S. cerevisiae CDC13) och C. elegans (CeOB1, CeOB2 och CeMRT-1, CeOB1 och CeMRT-1 har endast OB2-domän och analyserades med OB1 av de andra) som analyserades med användning av kluster X. ( C ) Ett fylogenetiskt träd av POT1-proteinerna i full längd och relaterade proteiner bland arter konstruerades med användning av Cluster X och MEGA4. ( D ) Ett schematiskt diagram över OB-vikningsdomänerna (OB1 och OB2) i POT1-proteiner i full längd från olika arter visades.

Bild i full storlek

Det förutsagda proteinet har 501 aminosyror med en N-terminal region (aminosyror 1–147) som är mycket bevarad bland andra arter (Fig. 1B, C). En domänanalys avslöjade närvaron av en OB-vikning som motsvarar OB1 (fig. 1D). Även om båda OB-veck av den humana POT1 har ssDNA-bindningskapacitet, är OB1 nödvändig för human POT1-bindning till ssDNA. C-terminalen hos humant POT1 är ansvarig för att associera med annat skyddskomplexprotein, såsom TPP1 15 . Följaktligen antog vi att SmedOB1 också kan vara involverad i ssDNA-bindning.

SmedOB1 krävs för vävnadshomeostas i Schmidtea mediterranea

För att dechiffrera rollen som SmedOB1 i planaria utförde vi först helmontering in situ hybridisering (WISH) -analys med SmedWi-1, en vuxen stamcellmarkör, som en positiv kontroll 16 . SmedOB1 uttrycktes allestädes närvarande i hela kroppen (Fig. 2A). För att bättre förstå funktionen av SmedOB1 genomförde vi RNAi-experiment i intakt Schmidtea mediterranea (fig. 2B). Maskarna matades med dubbelsträngade RNA (dsRNA) riktade mot SmedOB1. Det dsRNA-målriktade GFP tjänade som en negativ kontroll. Enligt RT-PCR-analys tystades SmedOB1 effektivt efter två omgångar med dsRNA-matning (fig. 2C). När vi undersökte de RNAi-behandlade maskarna, såg vi att SmedOB1-RNAi-plananerna var morfologiskt onormala jämfört med kontrollmaskarna. SmedOB1-RNAi-plananerna visade vävnadsskador nära svalget och bakom ögonfläckarna (mörkare regioner i kroppen) (fig. 2D och kompletterande fig. S3A). Med tiden delades dessa maskar antingen på platserna för dessa uppenbara vävnadsskador eller dog, vilket antyder en kritisk roll för SmedOB1 vid planarisk homeostas (fig. 2D, höger och fig. 2E).

( A ) ÖNSKA från SmedOB1 i planaria. SmedWi-1 användes som en positiv kontroll. ( B ) Ett flödesschema över dsRNA-utfodringsanalysen. ( C ) RNAi-effektivitet efter två omgångar med dsRNA-utfodring. OB1-1, OB1-2 och OB1-3 är tre olika dsRNA som är inriktade på SmedOB1. GFP RNAi är en negativ kontroll. ( D ) Fenotyper av planarianer efter matning med SmedOB1 dsRNA. Typiska fenotyper visas. ( E ) Resultat av statistisk analys av fenotypförhållandena hos plananer efter utfodring med SmedOB1 dsRNA. Varje grupp innehåller 30 maskar.

Bild i full storlek

SmedOB1 krävs för regenerering i Schmidtea mediterranea

När planarianer bestrålas med röntgenstrålar förlorar ASC: erna sin förmåga att sprida sig, och maskarna dör. Även stamcellsmarkörerna som SmedWi-1 kommer att minska 17 . Vi undersökte därför expressionsnivån för SmedOB1 efter röntgenstrålning. Såsom visas i tilläggsfiguren S4 minskade uttryckningsnivån för SmedOB1 till cirka 30% efter bestrålning (kompletterande figur S4), vilket ytterligare kopplade SmedOB1 till den planära regenereringsprocessen.

Därefter utvärderade vi effekten av SmedOB1 på regenerering efter amputation. Vi behandlade först maskarna med en omgång dsRNA-utfodring. Denna behandling ledde till en 60% reduktion av SmedOB1-transkriptionsnivån (fig. 3A). Maskarna skars sedan i tvärsnitt i tre sektioner och odlades ytterligare (fig. 3B). Cirka 4 dagar efter amputationen växte kontrollmaskarna nya vita sprängningar runt de skurna områdena i varje sektion, vilket indikerar framgångsrik vävnadsregenerering. I SmedOB1-RNAi-maskarna fanns emellertid en betydande försening i utseendet och omfattningen av blastema-tillväxten. Denna försenade regenereringsfenotyp observerades i alla tre sektionerna (huvudet, stammen och svansen) och var repeterbar i olika dsRNA-matningsgrupper (fig. 3C och kompletterande fig. S3B). Ovanstående resultat tyder på att SmedOB1 är involverad i vävnadsregenerationsprocessen hos plananer.

( A ) RNAi-effektivitet efter en omgång dsRNA-utfodring. ( B ) Ett flödesschema över dsRNA-matning och amputationsanalys. Skärningsdagen indikeras som dag 0. ( C ) Huvud-, bagage- och svansfragmenten regenererades 4 dagar efter amputation. Fenotypiska data samlades in med användning av en Zeiss SteREO Discovery V.20. Varje grupp inkluderade 5 maskar. En representativ mask visas. Skalstång: 1 mm. ( D ) q-PCR för de planära spridningsmarkörerna och vuxna stamcellsmarkörerna PCNA, Wi2, NB21.11e och Agat-1 i kontroll- och SmedOB1-RNAi-plananier.

Bild i full storlek

Stamcellerna hos plananer kan delas in i tre kategorier baserat på uttrycket av olika stamcellsmarkörer. Uttryck av Wi2 representerar det tidiga stadiet, högt uttryck av NB21.11e representerar medelsteget, och uttrycket av Agat-1 representerar det sena stadiet 17 . Alla tre stamcellmarkörerna nedreglerades hos plananer efter SmedOB1-knockdown (fig. 3D). Noterbart nedreglerades även proliferationsmarkören PCNA i dessa maskar. Dessa fynd pekar på ett minskat antal stamceller i SmedOB1 RNAi-maskar, möjligen på grund av den minskade spridningen av dessa celler.

SmedOB1 krävs för telomer DNA-proteinkomplexförening

Därefter testade vi om SmedOB1 också kunde binda enkelsträngat telomer-DNA. Vi beredde nukleära extraktet (NE) från planarianer som matades med en omgång dsRNA som var riktade mot GFP eller SmedOB1. Med samma lutning skiftade si-GFP NE sonden medan si-OB1 NE inte kunde flytta telomersonden (fig. 4A, spår 2-4 jämfört med spåren 5-7). Intressant nog finns det två skiftade band i si-GFP NE-gruppen. De övre skiftade banden kan vara ett multi-protein-telomere-komplex medan det undre skiftet indikerar som SmedOB1-telomer-komplex (fig. 4A, övre och mellersta pilar). Dessa resultat antydde att SmedOB1 kan vara funktionellt liknande humant POT1 och erfordras för bildning av proteintelomerkomplex. Därefter renades SFB-märkta SmedOB1 i full längd och human POT1 från eukaryota celler (fig. 4B) och inkuberades med en biotinmärkt telomerprobe (TTAGGG) 8 (fig. 4C). Som visas i fig. 4C skiftade den mänskliga POT1 sonden (fig. 4C, spår 6–8). Med en ökad gradient kunde SmedOB1 i full längd flytta oligosonden, även om signalen är relativt svagare än människans POT1 (Fig. 4C, spår 2-4). SFB-märkt GFP renad från humana 293T-celler användes som en negativ kontroll. För att kontrollera specificiteten av detta resultat användes FLAG-antikropp som kunde känna igen FLAG i SFB-taggen för superskiftreaktioner. FLAG-antikropp retarderade protein-ssDNA-komplexet till en högre molekylvikt, för både humant POT1 och SmedOB1, vilket tyder på framgångsrika överväxlingar (fig. 4C, spår 5 och 9). Vidare användes en (TTAGCC) 8- mutantprobe för inkubation med SmedOB1-proteinerna, ingen bindning kunde detekteras. vilket föreslår specificiteten för dess telomerbindning (Fig. 4D). Sammantaget bekräftade dessa resultat att SmedOB1 krävs för bildandet av telomer protein-DNA-komplex och att det associeras med telomere (TTAGGG) 8 ssDNA in vitro .

( A ) Kärnekstrakt (NE) erhölls från si-GFP- och si-SmedOB1-plantceller. EMSA-analys med angivna mängder NE och 1 nM (TTAGGG) 8- sond (spår 2–7). Bana 1, positiv kontroll medföljer satsen; spår 8, 12 nM renad human POT1 (slutlig koncentration), två pilar indikerade skiftade band (övre och mitten) och den nedre pilen indikerade den fria sonden. ( B ) Den C-terminala SFB-märkta GFP, human POT1 och SmedOB1 uttrycktes i 293T-celler och renades med SBP-tagg. Coomassie Blue-färgning av renad GFP-SFB, human POT1-SFB och SmedOB1-SFB. BSA-proteiner användes som kontroller. ( C ) Elektroforesmobilitetsskiftanalys (EMSA) för SmedOB1 i full längd med 1 nM (TTAGGG) 8 ssDNA-sond. Spår 1: 200 nM GFP-SFB; Spår 2–4: SmedOB1-SFB (50 nM – 200 nM); Bana 5: SmedPOT1-SFB (200 nM) plus FLAG-antikropp; Spår 6–8: human POT1-SFB (50 nM – 200 nM); Spår 9: human POT1-SFB (200 nM) plus FLAG-antikropp. Human POT1 användes som en positiv kontroll och GFP användes som negativ kontroll. Alla mängder avser slutkoncentration. Den övre pilen indikerade superskiftet, den mellersta pilen indikerade Protein-ssDNA-skiftet och den nedre pilen indikerade den fria sonden. ( D ) EMSA för fullängds SmedOB1 med 1 nM (TTAGGG) 8 telomersonde (spår 1–5) eller (TTAGCC) 8 mutantprobe (spår 6–10). Spår 1 och 6, inget protein; Spår 2 och 7: 200 nM GFP-SFB; Spår 3–5, 50 nM, 100 nM och 200 nM SmedOB1-SFB (OB1-SFB).

Bild i full storlek

SmedOB1 deltar i DNA-skadoresponsen och cellöverlevnad

POT1 är viktigt för att styra telomerlängden och skydda telomerändarna. Förlusten av humant POT1 resulterar i svar på DNA-skador vid telomerändarna, telomerförlängning, cellcykelstopp och celldöd 18, 19, 20, 21 . För att bättre förstå rollen för SmedOB1 i dessa biologiska processer utförde vi RNAi-experiment i intakt Schmidtea mediterranea (Fig. 2B, C). Sedan utförde vi hela-montering av immunofluorescensanalys med hjälp av en antikropp mot DNA-skademarkören yH2AX. SmedOB1 RNAi-plananierna uppvisade en signifikant ökning av yH2AX-signaler jämfört med GFP RNAi-kontrollmaskar (fig. 5A, B). I själva verket var det samma områden som uppvisade vävnadsskadorna (Fig. 2D). För att ytterligare bekräfta detta utförde vi en alkalisk kometanalys med användning av enstaka celler från SmedOB1 RNAi och kontrollplanörer. Alkalisk kometanalys detekterar både enkel- och dubbelsträngad DNA-brytning. SmedOB1-RNAi-planetära celler visade signifikant fler komet-svansar än GFP-RNAi-celler (fig. 5C, D). Dessa resultat indikerade att SmedOB1 troligtvis spelar en roll i DNA-skadesponsvägar.

( A ) Intakta Schmidtea mediterranea planarians matades GFP eller SmedOB1 dsRNA under två omgångar och utsattes för helmonterad immunofluorescens med användning av y-H2AX. ( B ) Kvantifieringen av y-H2AX analyserades i ImageJ-programvaran. ( C ) Alkalisk kometanalys utfördes med användning av enstaka celler från planärer matade med GFP eller SmedOB1 dsRNA. ( D ) Kvantifieringen av alkalisk kometanalys analyserades i CASP-mjukvara. ( E ) Schmidtea mediterranea planarians matades GFP och SmedOB1 dsRNA under två omgångar och amputerades sedan. Efter regenerering i 8 dagar färgades plananerna med helfärgning med en in situ Cell Death Detection Kit, Fluorescein (Roche) och DAPI. Planarianer behandlade med DNase I användes som en positiv kontroll. ( F ) Kvantifieringen av ΤUNEL analyserades i ImageJ-programvaran.

Bild i full storlek

Apoptos-signalen stimuleras i amputerade maskar 22 . Nästa gång amputerade vi de RNAi-behandlade maskarna och utförde TUNEL-analyser. Efter regenerering upptäckte vi en signifikant ökning av de apoptotiska signalerna i SmedOB1-RNAi-plananerna jämfört med kontrollgruppen (Fig. 5E, F). Dessa resultat indikerar att SmedOB1 reglerar planarisk homeostas genom att hämma DNA-skada och celloptoptos.

Funktionell identifiering av DjOB1 i den planariska Dugesia japonica

Den planariska Dugesia japonica innehåller också en TTAGGG-telomerupprepningssekvens (Kompletterande Fig. S1). Därför undersökte vi om OB1 är bevarad i den planiska arten Dugesia japonica (Dj). En databasökning och -analys identifierade en Unigene 34129 23, 24, och vi använde PCR för att klona en 508-bp partiell DjOB1-sekvens. Vi genererade sedan dsRNA baserat på denna sekvens (fig. 6A) och genomförde RNAi-experiment i Dugesia japonica . Efter utfodring minskades DjOB1-nivåerna dramatiskt (Fig. 6B). I likhet med SmedOB1-RNAi-maskarna observerade vi minskat uttryck av proliferationsmarkören PCNA (fig. 6B), och de flesta av DjOB1-RNAi Dugesia japonica visade vävnadsskador på huvudögonen, farynx eller båda, medan GFP-kontrollbehandlade maskar var helt normala (Fig. 6C, D). Dessa resultat tyder på att den planära OB1-genen är funktionellt konserverad bland planära arter.

( A ) PCR-kloning av en partiell DjOB1-sekvensbas på Unigene 34129. ( B ) RT-PCR-analys efter två omgångar med dsRNA-matning. DjPCNA och DjOB1 analyserades och DjEF2 användes som en intern kontroll. ( C ) Fenotyper av Dugesia japonica efter två omgångar med dsRNA-utfodring. ( D ) Statistisk kvantifiering av andelen onormala flatmaskar i Dugesia japonica efter RNAi DjOB1. Planarianerna med skador på huvudet, svelget eller båda analyserades.

Bild i full storlek

Diskussion

Pot1 är en viktig gen, men borttagning eller mutation av Pot1 är associerad med olika fenotyper i olika arter. Exempelvis leder borttagning av Pot1 i S.pombe till snabb telomerförlust, medan hämningen av POT1 hos människor ökar telomerlängden 8 . Således, när vi identifierade en POT1-homolog i planaria som heter SmedOB1, var det av intresse att avgöra om SmedOB1 reglerar telomerer i planaria och undersöka fenotyperna av planaria behandlade med RNAi. Våra resultat visade att bristen på SmedOB1 i flatmask orsakade vävnadsskador och regenereringsfel på individnivå. Således krävs SmedOB1 för planarisk homeostas och regenerering. Mekaniskt kan vi antaga att SmedOB1 kan reglera ASC-funktionen genom att främja ASC-spridning och hämma DNA-skada och cellapoptos på ett telomerberoende sätt.

Uttrycksmönstret för SmedOB1 indikerade att alla cellerna i en planarian uttrycker OB1-genen, men RNAi-fenotypen observerades först i områdena runt svalg och runt ögonfläckarna, där färre ASC: er finns 17 . Vi ansåg att denna skillnad inträffade eftersom när vävnad skadas skickar den plana ASC-poolen stamcellsavkommor för att migrera till de skadade platserna, där de fullbordar uppdelning och differentiering. Eftersom områdena runt svalget och ögonfläckarna har få ASC: er kan skador runt dessa områden inte läka snabbt. SmedOB1-uttryck är inte begränsat till ASC: er men är allestädes närvarande och observeras i både ASC: er och somatiska celler; alltså är det viktigt för hela kroppens homeostas.

Den planära flatmasken är en idealisk modell för att studera regenerering och stamceller, och många hypoteser som tidigare baserades på resultaten från in vitro- experiment kan bekräftas med in vivo- experiment i planaria. Eftersom planaria har samma telomerupprepningssekvens som människor tror vi vidare att planaria också kommer att vara lämplig för telomerstudier. Vi studerade SmedOB1 i planaria eftersom dess sekvens är bevarad bland alla skyddskomplexen, medan inga andra telomera proteiner kunde förutsägas i planärer genom BLAST-analys av konserverade domäner. Här fann vi att SmedOB1 associerar sig med telomeren TTAGGG-sekvens in vitro och krävs för planarisk homeostas och regenerering. De fylogenetiska och funktionella konservationerna av SmedOB1 tillhandahåller en av mekanismerna genom vilka planörer upprätthåller telomerer och genomstabilitet för att säkerställa deras odödlighet. Intressant nog fann vi också att förutom SmedOB1 själv kan det finnas ett potentiellt multi-protein-telomere-komplex hos planarian, vilket antyder andra oidentifierade telomerassocierande proteiner som finns i denna art (fig. 4A). Ytterligare studier som belyser dessa proteiner eller komplex skulle göra stora ansträngningar för detta område.

SmedOB1 är det första telomer-associerade proteinet som hittills identifierats i planaria. Telomerstrukturen är komplicerad och underhållet av telomerstruktur, längd och funktion kräver flera proteiner såväl som TERRA 5 . Genom att använda biokemiska metoder med hög genomströmning, såsom proteomik för isolerade kromatinsegment (PiCH), DNA-proteinaffinitetsanalyser och kvantitativ proteomik, kommer okända planära telomera proteiner att identifieras inom en snar framtid. Ett komplett telomeriskt proteinnätverk kommer att ge ytterligare insikter om telomerreglering i planärisk stamcellbiologi för vuxna. Ytterligare studier kommer att belysa människors förnyelsemedicin.

metoder

Planariska kulturer

Den asexuella stammen av Schmidtea mediterranea bibehölls i 1X Montjuic-vatten vid 20 ° C såsom tidigare beskrivits 25 . En klonal linje av den blandade asexuella stammen av Dugesia japonica härleddes från en enda mask som samlats upp från Beibei-berget i Chongqing och hölls i filtrerat kranvatten vid 22 ° C. Maskarna matades med nötköttlever en gång i veckan och svält i minst en vecka före alla experimenten. För bestrålning exponerades plananerna för röntgenstrålar vid 5 Gy eller 10 Gy och hölls sedan i odlingsmedium under 4 dagar före RNA-extraktion.

Identifiering och kloning av SmedOB1 och DjOB1

En BLAST-baserad ömsesidig metod för bästa hit, i kombination med proteinsekvensinriktning, användes för att identifiera ortologa POT1-gener hos plananer som tidigare rapporterats 25 . I korthet användes den mänskliga POT1-isoformen 1 för att utföra en tBLASTn-sökning i Schmidtea mediterranea- genomdatabasen SmedGD 2.0 (//smedgd.stowers.org) med ett e-värde av 1e-08. Den genomiska sekvensen (V31.002347: 3945..3613) översattes sedan och jämfördes med humana sekvenser med användning av NCBI BLAST-verktyg.

För att klona SmedOB1 konstruerades RACE-primrar i enlighet därmed och 5 "RACE och 3" RACE utfördes med användning av FirstChoice® RLM-RACE Kit (Thermo Scientific). PCR-produkterna TA-klonades med användning av pEASY-T1-vektorn (Transgen) för sekvensverifiering. Följande primrar användes: 5′RACE inre primer FP: ATCCTAgggAgATTTTCAgg; 5 ′ RACE gs primer RP: AAATACAGCCACGTTGAATCCT; 3′RACE ytterprimer: GATTTTACTGCTTTAACAGATG; 3′RACE inre primer: AGGATTCAACGTGGCTGTATTT. En partiell Dugesia japonica POT1-homolog (DjOB1) klonades med PCR med användning av följande primrar. DjOB1 FP: 5′-ATTACAAAGACAAGCCTCAG-3 ′; DjOB1 RP: 5′-GAAAATAAACATAATCTCCTGG-3 ′.

DsRNA-medierad knockdown hos planärer

DsRNA för genutsläpp transkriberades in vitro med mMESSAGE mMACHINE T7-kit (Ambion). PCR-mallarna genererades med T7-promotorsekvenser i båda ändarna och matades sedan till maskarna som tidigare beskrivits 26 . Tio mikrogram dsRNA användes för varje tio maskar. GFP dsRNA användes som negativa kontroller. Tre olika dsRNA: er som riktade sig till olika regioner av SmedOB1 användes. Följande primrar användes: SmedOB1–1 FP-T7: taatacgactcactatagggTACGATTTTACTGCTT; SmedOB1-1 RP-T7: taatacgactcactatagggAAATACAGCCACGTTG; SmedOB1-2 FP-T7: taatacgactcactatagggTCAAAAAACTATTTGATAGATACAT; SmedOB1-2 RP-T7: taatacgactcactatagggTTCAAGTCTTGCGAGTAA; SmedOB1-3 FP-T7: taatacgactcactatagggTGATAAATTACTCGCAAGAC; SmedOB1-3 RP-T7: taatacgactcactatagggTTCCCTTCAATCCATCC. Under en matningsrunda behandlades maskarna tre gånger på en vecka (dag 1, 4 och 7, fig. 3B). Under två matningsrunder behandlades maskarna vid olika tidpunkter under en tre veckors period (dag 1, 4, 7, 14, 17 och 20, fig. 2B).

Helmontering in situ hybridisering (WISH)

WISH-experiment utfördes som tidigare beskrivits 25 . Hybridisering in situ av telomererna utfördes med användning av en metafasspridning och en PNA-TelC-FITC-sond (Panagene) såsom tidigare rapporterats 14 . Visualisering utfördes på Zeiss SteREO Discovery V.20. WISH-proberna framställdes med användning av DIG RNA-märkningssatsen (T7 / SP6) (Roche). Sondmallema producerades med PCR med en T7-promotorsekvens tillagd till 5'-änden. Antisensproberna för SmedOB1 och Smedwi-1 genererades med följande primers: SmedOB1 FP: AAGGAATGTTTTGAACG; SmedOB1 RP: TAATACGACTCACTATAGGGTACTGCTGACTTTCCTT. Smedwi-1 FP: TACAGCCTGATACAGTTAC; Smedwi-1 RP: taatacgactcactatagggTTGTAGTAGAATACCCTCC.

Kvantitativ PCR

RNA extraherades med TRIzol (Invitrogen) och reverserades transkriberades med iScript cDNA Syntes-kit (Bio-Rad). q-PCR utfördes med användning av GoTaq qPCR-kit (Promega). Grunderna listas nedan. Cystatin användes som den interna referensen. Smedwi-2 qFP: CTGCAAAAGATTACCTATGCTCTAACT; Smedwi-2 qRP: ACGGGATTAGAGCCCTTATGCAC; SmedNB.21.11e qFP: GTCTCCCGCCAAATCAAGTA; SmedNB.21.11e qRP: TTTCATGCAATCTGCTTTCG; SmedAgat1 qFP: GTTGGTTGAAAAGCGAGAGGTT; SmedAgat1 qRP: CGAACATCGGAAGTCCAACAATG; SmedCystatin qFP: AACTCCATGGCTAGAACCGAA; SmedCystatin qRP: CCGTCGGGTAATCCAAGTACA;

SmedOB1 qFP: TGTTGAACCCCCTCTTAACG; SmedOB1 qRP: GATGCAATCAGCTACGCAAG. DjEF2 FP: 5′-GCAATCGAAGACGTTCCATGTG-3 ′;

DjEF2 RP: 5′-CCAGGAAAAGTTGTTATAGTCCCAGTTT-3 ′; DjPCNA FP: 5′-ATGCCTTGGAAGCAATGATTCTTTAACAAT-3 ′; DjPCNA RP: 5′-TAAATGGTCTCCCTCTATATCCATCAATTT-3 ′; DjOB1 FP: 5′-GAAATTCAATGCCATCTTCAGAG-3 ′; DjOB1 RP: 5′-CACAAGCAGGAACAGTACCGTC-3 ′.

Proteinrening och elektroforetisk mobilitetsskiftanalys (EMSA)

Kärnekstrakt (NE) erhölls från plananer efter en omgång dsRNA-matning och svält under en vecka, med användning av NE-PER kärnkrafts- och cytoplasmiska extraktionsreagens (Thermo Scientific). 293T uttryckte SFB-märkt fullängds human POT1 och SmedOB1 renades med användning av högkapacitet Streptavidin Agarose (Thermo Scientific) och 2 mM Biotin (Sigma-Aldrich) eluering, verifierad med SDS-PAGE och inkuberades sedan (i olika koncentrationer) med en biotin -märkt telomer enkelsträngad DNA-sond (TTAGGG) 8 eller mutantprobe (TTAGCC) 8 (syntetiserad i Thermo Scientific) vid rumstemperatur under 30 minuter. Reaktionerna upplöstes sedan genom elektrofores och blottades för biotindetektion med användning av Chemiluminescent Nucleic Acid Detection Module (Thermo Scientific). För överväxling användes FLAG-antikropp (Abmart) i en slutkoncentration av 50 ug / ml.

Helmonterad immunfärgning och kometanalys

IF utfördes som tidigare rapporterats 25 . I korthet rehydratiserades fixerade och blekta maskar i graderade PBSTx (PBS + 0, 3% Triton X-100) / metanollösningar, blockerades i PBSTx innehållande 0, 25% BSA (Sigma-Aldrich) och inkuberades med primära antikroppar över natten vid 4 ° C ( y-H2AX, Millipore). Efter omfattande tvättning med PBSTx inkuberades prover med Alexa Fluor 488-konjugerad sekundär antikropp och monterades med användning av fluorescerande monteringsmedium (Dako). Alkalisk kometanalys utfördes i enlighet med tillverkarens protokoll (Trevigen). DNA färgades av Gel-Red (Beyotime) och fotograferades i Zeiss SteREO Discovery V.20. Kvantifieringen av data analyserades i CASP-programvaran.

TUNEL-analys

TUNEL-analyser med användning av plananerna utfördes såsom beskrivits tidigare 25 . I korthet avlivades maskarna i 10% n-acetylcystein (Sigma), fixerades i 4% formaldehyd och permeabiliserades i 1% SDS (under 20 minuter) innan de blektes över natten i 6% H202 (utspäddes i 1x PBST ). Efter tvättningarna i 1xPBST och 1xPBS inkuberades maskarna med det terminala överföringsenzymet (Roche) under 1 timme vid 37 ° C, och maskar behandlade med DNas I (NEB) under 10 minuter vid RT användes som positiva kontroller. Planarianerna inkuberades med DAPI i 10 minuter innan de monterades. Signalerna fotograferades i Zeiss SteREO Discovery V.20. Kvantifieringen av data analyserades i ImageJ-programvaran.

Dataanalys

All statistikinformation presenteras som medel ± SD-skivor. Den statistiska signifikansen för skillnader mellan två medel beräknades med hjälp av studentens t-test. Sannolikhetsnivån som accepterades för signifikans var P <0, 05 (*) och P <0, 01 (**).

ytterligare information

Hur man citerar den här artikeln : Yin, S. et al. SmedOB1 krävs för planarisk homeostas och regenerering. Sci. Rep. 6, 34013; doi: 10.1038 / srep34013 (2016).

Kompletterande information

PDF-filer

  1. 1.

    Kompletterande information

kommentarer

Genom att skicka en kommentar samtycker du till att följa våra villkor och gemenskapsriktlinjer. Om du finner något missbruk eller som inte överensstämmer med våra villkor eller riktlinjer ska du markera det som olämpligt.