Reglering av t-cellaktivering och migration av kinaset tbk1 under neuroinflammation | naturkommunikation

Reglering av t-cellaktivering och migration av kinaset tbk1 under neuroinflammation | naturkommunikation

Anonim

ämnen

  • Autoimmunitet immunitet~~POS=HEADCOMP
  • Inflammation
  • neuroimmunologi
  • T-celler

Abstrakt

Utveckling av ett immunsvar eller autoimmunt svar involverar T-cellaktivering i lymfoida organ och efterföljande migration till perifera vävnader. Här visar vi att T-cellspecifik ablation av kinaset TBK1 främjar T-cellaktivering men orsakar retention av effektor T-celler i den dränerande lymfkörteln i en neuroinflammatorisk autoimmunitetsmodell, experimentell autoimmun encefalomyelit (EAE). Vid äldre åldrar ackumulerar T-cellkonditionerade TBK1-knockout-möss också spontant T-celler med aktiverad fenotyp. TBK1 styr aktiveringen av AKT och dess nedströms kinas mTORC1 genom en mekanism som involverar TBK1-stimulerad AKT-ubikvitering och nedbrytning. Den avreglerade AKT-mTORC1-signaleringen bidrar i sin tur till förbättrad T-cellaktivering och försämrad effektor T-cellutgång från dränering av lymfkörtlar. Behandling av möss med en liten molekylinhibitor av TBK1 hämmar EAE-induktion. Dessa resultat antyder en roll för TBK1 vid reglering av T-cellmigrering och etablering av TBK1 som en regulator för AKT-mTORC1-signalaxeln.

Introduktion

Autoimmunitet inträffar som ett resultat av T-cellaktivering av antigener härledda från självvävnader 1 Efter priming av självantigenen i perifera lymfoida organ, migrerar autoimmuna effektor T-celler till målorgan för att förmedla inflammation och vävnadsskada. Det centrala nervsystemet (CNS) är ett organ med ett antal autoimmuna och inflammatoriska störningar, inklusive multipel skleros (MS), en sjukdom som kännetecknas av kronisk inflammation, demyelinisering och neuronal skada 2 . En djurmodell, experimentell autoimmun encefalomyelit (EAE), har visat sig vara kraftfull för att undersöka patogenesen av MS 3 . Man tror allmänt att auto-immuna T-celler i MS och EAE primeras av myelinspecifika antigener och migrerar sedan över blod-hjärnbarriären för att komma in i CNS, där de återaktiveras och medierar inflammation och neuronal skada 4, 5 . T-cellprimingen och -differentieringen styrs av signaltransduktion medierad av TCR och en costimulatorisk molekyl, CD28, såväl som cytokinsignaler 6 . Emellertid är signalmekanismen som reglerar migration av T-celler från lymfoida organ till vävnaderna av autoimmunitet, såsom CNS, fortfarande dåligt definierad.

TBK1, liksom dess homologa kinas IKKε, är kända som mediatorer av induktion av typ I-interferon (IFN) vid antiviral medfödd immunitet 7, 8, 9, 10, 11 . TBK1 och IKKε delar strukturell homologi med IKKα och IKKp, typiska IKK-komponenter som medierar aktivering av transkriptionsfaktorn NF-KB 12, 13 . Till skillnad från de typiska IKK: erna är TBK1 och IKKε emellertid dispenserbara för NF-KB-aktivering men krävs för aktivering av IFN-responsiv faktor 3, en transkriptionsfaktor som medierar typ I IFN-genuttryck 14 . Hittills är de atypiska IKK: s roller i andra biologiska processer dåligt definierade. I synnerhet har studien av in vivo- funktionen av TBK1 hindrats av den embryonala dödligheten hos de konventionella TBK1-knockout (KO) -möss 15 .

I den aktuella studien använde vi en villkorad Tbk1- KO-strategi och demonstrerade en oväntad roll för TBK1 i regleringen av T-cellfunktion och autoimmunitet. T-cellspecifik ablation av TBK1 störd T-cellshomeostas, kännetecknad av en ökad frekvens av T-celler med en aktiverad fenotyp, och gjorde naiva T-celler mer känsliga för aktivering av agonistiska antikroppar för TCR och CD28. Överraskande nog var de T- cellkonditionerade Tbk1- KO (nedan kallade Tbk1- TKO) möss eldfasta mot induktionen av EAE på grund av försämrad migration av autoimmuna T-celler från de dränerande lymfkörtlarna till CNS. Våra data antyder att TBK1 medierar utträngning av effektor T-celler från dränering av lymfkörtlar i en mekanism som involverar negativ reglering av kinaserna AKT och mTORC1.

Resultat

TBK1 är ett kinas som svarar på T-cellaktiveringssignaler

Vår första analys av BioGPS-databasen avslöjade att förutom makrofager hade lymfocyter ett rikligt uttryck av TBK1 (data visas inte). För att bedöma funktionen av TBK1 i T-celler undersökte vi dess förmåga att svara på signaler stimulerade av TCR- och CD28-agonistiska antikroppar (anti-CD3 och anti-CD28) eller mitogener (PMA och ionomycin) som aktiverar proteinkinas C och kalciumvägar nedströms TCR och CD28. Trots att den var känd som en medfödd immunförmedlare aktiverades TBK1, såväl som dess homolog IKKε, starkt av T-cellaktiveringssignalerna, såsom visas med både fosfospecifik immunblot (IB) och in vitro -kinasanalyser (Fig. 1a, b). Aktivering av det typiska IKK-komplexet med T-cellaktiveringssignaler kräver ett ställningprotein, CARMA1 (refs 16, 17). Intressant nog krävdes CARMA1 också för aktivering av TBK1 och IKKε (fig. Ib). Vidare var aktivering av IKKε fullständigt beroende av IKK, eftersom den blockerades i T-celler som saknade IKK-regulatorisk underenhet NEMO eller den IKK-katalytiska underenheten IKKp (fig. Ib). Å andra sidan inhiberades aktiveringen av TBK1 endast delvis i de NEMO- och IKKp-defekta T-cellerna (Fig. Ib). Liknande resultat erhölls med användning av Jurkat T-celler som saknade CARMA1 (JPM50.6) (ref. 17) eller NEMO (JM4.5.2; ref. 18; Fig. 1c). Således aktiveras både TBK1 och IKKε av T-cellaktiveringssignaler, även om den underliggande mekanismen tycktes vara annorlunda för dessa kinaser.

( a ) IB-analys av fosforylerade (P-) TBK1 (Ser172) och total TBK1 i WT CD4 + T-celler (6-veckor gamla möss), stimulerad med anti-CD3 plus anti-CD28 med användning av en tvärbindningsmetod eller med mitogenerna PMA plus jonomycin. ( b ) CD4 + T-celler från de angivna KO- eller T-cellvillkorade KO (TKO) och interna WT-kontrollmöss (6 veckor) behandlades med PMA plus jonomycin. TBK1, IKKε och det kanoniska IKK-komplexet isolerades med IP från celllysatema och utsattes för in vitro -kinasanalyser (KA) med användning av GST-IRF3 (för TBK1 och IKKε) eller GST-IKBa (för IKK) rekombinanta proteiner som substrat. ( c ) TBKl-, IKKε- och IKK-kinasanalyser utfördes med användning av Jurkat och derivatceller som beskrivits i b . Data är representativa för tre eller flera oberoende experiment.

Bild i full storlek

TBK1 reglerar T-cellaktivering

För att studera TBK1: s roll i reglering av T-cellfunktionen genererade vi Tbk1 -TKO-möss genom att korsa Tbk1- flussade möss med CD4-Cre-möss. Som förväntat ablaterades TBK1 i T-celler men inte i B-celler (kompletterande figur la). Den T-cellspecifika TBK1-ablationen förändrade inte nämnvärt mönstret för tymocytutveckling (kompletterande figur Ib, c). De unga (6 veckor gamla) Tbk1- TKO och vildtyp (WT) kontrollmöss hade också jämförbara antal CD4 + och CD8 + T-celler i olika lymfoida organ (kompletterande figur 1d), vilket tyder på normal överlevnad och homing av naiva T celler i Tbk1- TKO-möss i unga åldrar. Intressant, emellertid, vid en äldre ålder (4 månader gammal) hade Tbk1 -TKO-mössen splenomegali och högre splenocytantal (Fig. 2a) samt ökat antal CD4 + och CD8 + T-celler i olika lymfoida organ och perifera organ blod (kompletterande bild 1e).

( a ) En representativ miltbild och medelvärde ± sd-värden på mjältcellnummer för 4-månaders gamla WT- och Tbk1 -TKO-möss (varje cirkel representerar en mus, n = 8). ( b ) Proliferation och ELISA (IL-2, IFN-y och GM-CSF) analyser av CD4 + T-celler renade från mjälten hos unga (6 veckor, n = 4) WT- och TKO-möss och stimulerades under 48 timmar med indikerade koncentrationer av plattbundet anti-CD3 och anti-CD28. ( c ) Flödescytometriska analyser av milt CD4 + T-celler stimulerades under 4 timmar med PMA och ionomycin i närvaro av monensin. Frekvensen för IFN-y-producerande och GM-CSF-producerande T-celler presenteras som ett representativt fluorescensaktiverat cellsorteringsdiagram (vänster) och medelvärde ± sd-värden (höger) för flera möss (6 veckor, WT = 3, TKO = 4). ( d, e ) Flödescytometriska analyser av frekvensen för naiv (CD44 lo CD62L hi ) och minne (CD44 hi CD62L lo ) CD4 + T-celler i WT och Tbk1 -TKO ( d, n = 3) eller WT och IKKε- KO ( e, n = 4) möss (6 veckor gamla). Siffror i kvadrant anger procentandelen celler bland totala CD4 + T-celler. Data är representativa plott (vänster) och medelvärden ± sd-värden (höger). ( f, g ) Flödescytometrisk analys av naiva (CD44 lo CD62L hi ) och minne (CD44 hi CD62L lo ) CD4 + T-celler från dödligt bestrålade Rag1- KO-möss rekonstituerade med en blandning (1: 1-förhållande) benmärgsceller härledda från möss från WT B6.SJL (CD45.1 + ) och WT eller TKO (CD45.2 + ) ( n = 6). Data är representativa plott ( f ) och medelvärden ± sd-värden ( g ). Data representerar medelvärde ± sd från tre eller flera oberoende experiment. * P <0, 05; ** P <0, 01; *** P <0, 001; **** P <0, 0001; NS, icke-signifikant som bestämdes av två-tailed uparad Student t- test, jämför de angivna grupperna.

Bild i full storlek

För att undersöka effekten av TBK1-brist på T-cellaktivering, använde vi naiva CD4 + T-celler härledda från de 6 veckor gamla mössen. När de stimulerades in vitro visade WT- och TBK1-bristna naiva CD4 + T-celler liknande nivå av apoptos (kompletterande figur 1f). Intressant nog uppvisade emellertid de TBK1-bristna naiva CD4 + T-cellerna en högre förmåga att sprida sig som svar på lägre doser av anti-CD3 (fig. 2b). Dessutom producerade de stimulerade TBK1-bristfulla T-cellerna anmärkningsvärt högre nivåer av IFN-y, som detekterades av både enzymbunden immunosorbentanalys (ELISA) och flödescytometri-analyser (fig. 2b, c). Å andra sidan främjade TBK1-bristen inte väsentligt uttrycket av två andra cytokiner, interleukin (IL-2) och granulocyt-makrofag kolonistimulerande faktor (GM-CSF; Fig. 2b, c). Flödescytometri-analyser avslöjade att Tbk1-TKO-mössen hade en högre frekvens av aktiverade eller minnesliknande T-celler, kännetecknade av CD44hiCD62Llo-ytmarkörerna och samtidigt minskning i procent av naiva (CD44loCD62Lhi) T-celler (fig. 2d). Denna fenotyp detekterades inte hos möss som saknade TBK1-homologen, IKKε (fig. 2e), vilket antyder en unik funktion av TBK1. Med användning av en Cre-ER-inducerbar KO-metod fann vi att TBK1-ablation hos vuxna möss (kompletterande fig. 2a) också orsakade en ökning av frekvensen för aktiverade T-celler i mjälten (kompletterande fig. 2b) utan att påverka tymocytutvecklingen ( Kompletterande figur 2c, d). Således tycktes TBK1 ha en icke-redundant roll vid reglering av stabiliseringsstatusaktivering och homeostas av T-celler.

Perturbed T-cell-homeostas kan bero på en cellinre mekanism eller nedsatt Treg-funktion. Vi behandlade mekanismen för TBK1-funktion genom överföring av blandad benmärg. Under sådana förhållanden utvecklades och upprätthölls WT- och Tbk1- TKO-T-cellerna i samma miljö och i närvaro av WT Treg-celler, vilket möjliggör bedömning av cellintrinsiska funktioner hos TBK1. Vi överförde WT-benmärg från WT-möss som uttryckte CD45.1 medfödd markör (B6.SJL) tillsammans med antingen WT- eller Tbk1 -TKO-benmärg (CD45.2 + ) till dödligt bestrålade Rag1- KO-möss. Som förväntat hade CD45.1 + och CD45.2 + WT T-cellerna i de blandade chimära mössen från benmärgen liknande frekvens av minne och naiva CD4 + T-celler (fig. 2f, vänsterpaneler). Däremot hade Tbk1 -TKO (CD45.2 + ) CD4 + T-celler en mycket högre frekvens av minnespopulation jämfört med WT (CD45.1 + ) CD4 + T-celler inom samma chimära möss (fig. 2f, höger paneler och fig. 2g). Dessa data tyder på att TBK1 har en cellintresserad roll i regleringen av stabiliseringsstatusaktivering och homeostas av T-celler.

TBK1 är viktigt för EAE-induktion

Eftersom den reducerade tröskeln för T-cellaktivering ofta främjar autoimmunitet undersökte vi rollen för TBK1 i regleringen av en T-cellberoende autoimmunitet, EAE. Patogenesen för EAE involverar den inflammatoriska verkan av CD4 + T-hjälpare 17 (Th17) och Thl-celler, som kännetecknas av produktionen av signaturcytokinerna IL-17 respektive IFN-y 3 . Immunisering av WT-möss med ett myelin-specifikt autoantigen, myelin-oligodendrocyt-glykoprotein (MOG) -peptid MOG 35–55, ledde till induktion av öppna EAE-kliniska poäng (Fig. 3a). Överraskande nog var Tbkl- TKO-mössen inte överkänsliga, utan snarare anmärkningsvärt resistenta mot EAE-induktion (fig. 3a). Histologiska analyser avslöjade drastisk reduktion i CNS-infiltrerande immunceller och CD4 + T-celler i Tbk1 -TKO-mössen (Fig. 3b, vänster och mitten). Dessutom, i överensstämmelse med de kliniska poängen, hade ryggmärgen i WT, men inte Tbk1- TKO, möss allvarlig demyelinisering (Fig. 3b, höger). Parallella analyser av flödescytometri bekräftade den drastiska reduktionen i antalet CD4 + och CD8 + T-celler i CNS hos EAE-inducerade Tbk1- TKO-möss (Fig. 3c). Den EAE-eldfasta fenotypen av Tbk1 -TKO-möss var osannolik på grund av en defekt i inflammatorisk T-cellproduktion, eftersom de TBK1-bristna CD4 + T-cellerna genererade högre nivåer av Th1- och Th17-celler än WT CD4 + T-celler i en i in vitro- differentieringsanalys (kompletterande figur 3). Konsekvent, trots det drastiskt reducerade T-cellantalet i CNS för Tbk1- TKO-möss, är procentandelen av effektor-T-cellerna som uttrycker IFN-y (Th1), IL-17A (Th17) eller GM-CSF inom CD4 + T- cellpopulationen i CNS, mjälten eller dränerande lymfkörtel hos Tbk1- TKO-möss var antingen högre än eller liknande den för WT-kontrollmössen (Fig. 3d – f). Noterbart ökade det absoluta antalet av de inflammatoriska effektor-CD4 + T-cellerna drastiskt i de dränerande lymfkörtlarna från Tbk1 -TKO-mössen på grund av ackumuleringen av totala CD4 + T-celler (fig. 3g). Dessa resultat antyder att även om TBK1-brist främjar T-cellaktivering och -differentiering, dämpar den EAE-induktion troligen genom att blockera migrationen av effektor-T-cellerna från de dränerande lymfkörtlarna till CNS.

( a ) EAE-sjukdomsscore för WT ( n = 5) och Tbk1 -TKO ( n = 4) möss. ( b ) Haematoxylin och eosin (H&E), CD4 IHC och Luxol Fast Blue (LFB) färgning av ryggmärgsavsnitt från MOG 35–55- immuniserade WT- och TKO EAE-möss (28 dagar efter immunisering). Skalstänger, 500 μm. Data är representativa för tre oberoende experiment. ( c ) Flödescytometri bestämning av medelvärdena ± sd-värden för CD4 + T-cellnummer och CD8 + T-cellnummer utvunnits från CNS för WT- och Tbk1- TKO-möss 18 dagar efter EAE-induktion. ( d - f ) Flödescytometriska analyser av CD4 + T-celler från CNS, mjälte och lymfkörtlar hos de EAE-inducerade möss beskrivna i en (18 dagar efter EAE-induktion). T-cellerna stimulerades under 4 timmar med PMA och ionomycin i närvaro av monensin, följt av flödescytometri-analys av IFN-y, IL-17A och GM-CSF-producerande celler. ( g ) Medel ± sd-värden för absoluta antal IFN-y, IL-17A- och GM-CSF-producerande CD4 + T-celler utvunnna från den dränerande lymfkörteln (dLN) för WT- eller Tbk1- TKO-möss beskrivna i en . Data representerar medelvärde ± sd från tre eller flera oberoende experiment. * P <0, 05; ** P <0, 01; *** P <0, 001; NS, icke-signifikant såsom bestämdes genom tvåvägsanalys av varians med Bonferronis posttest för klinisk poänganalys av EAE och tvåparad studentparts-test för annan analys, jämför de angivna grupperna.

Bild i full storlek

För att ytterligare undersöka den EAE-reglerande funktionen hos TBK1 undersökte vi rollen för TBK1 i regleringen av migrering av autoimmuna T-celler till CNS. Eftersom TBK1-brist inte minskade cellulariteten eller delmängdskompositionen av T-celler i lymfkörtlarna (Kompletterande figur 1d, e), är det troligt att TBK1 är dispenserbara för T-cells hem till lymfkörtlarna. Faktiskt överförde adoptivt Tbk1 -TKO CD4 + T-celler effektivt till mjälten och lymfkörtlarna i de T-cell- bristna Tcrb / d- KO-mössen (fig. 4a). I själva verket ökade T-cellcellulariteten hos Tbk1 -TKO-möss måttligt i lymfoida organ och minskade i perifert blod, jämfört med WT-möss (Fig. 4a). Även om Tbk1- TKO-möss uppvisade reducerad frekvens av CD62L hi T-celler (fig. 2d) så hade de således inte en defekt i T-cellets hem till lymfkörtlarna som visas för CD62L-bristande möss 19, 20 .

( a ) WT- och Tbkl -TKO-naiva CD4 + -celler märktes med CMRA respektive CFSE, och överfördes adoptivt till Tcrb / d- KO-möss i en blandning (vid 1: 1-förhållande). Cellfördelning i olika organ analyserades 16 timmar senare genom flödescytometri ( n = 4). ( b ) Dödligt bestrålade Ragl- KO-möss rekonstituerades med en blandning (1: 1-förhållande) av benmärgsceller isolerade från Tbk1- TKO och GFP-uttryckande WT-möss ( n = 10). De chimära mössen immuniserades med MOG 35–55 6 veckor efter rekonstitution. CNS och dränerande LN (dLN) CD4 + T-celler analyserades baserat på GFP-uttryck gated på CD4 + cell på dag 14 efter EAE-induktion. ( c - e ) WT och Tbk1- TKO naiva CD4 + -celler märktes med CMRA respektive CFSE respektive och överfördes adoptivt till WT-möss i förhållandet 1: 1, följt av MOG 35–55- immunisering. Fem dagar senare utsattes mottagarmöss för flödescytometri-analys av cellfördelning i olika organ ( c ) eller konfokal avbildning av de differentiellt märkta T-cellerna i en dränerande LN, som visar hela T-cellzonen (vänster) och perifera regionen ( höger) ( d, röda, CMRA-märkta WT T-celler; gröna, CFSE-märkta Tbk1- TKO T-celler; blå, LYVE-1 + lymfkärl). TKO: WT T-cellförhållande i T-cellzonen (inställd på ett index av 1: 1) och lymfkärl presenteras som medelvärden ± sd-värden baserat på tre experiment med totalt> 500 T-celler analyserade ( e ) . ( f, g ) Kliniska poäng ( f ) och flödescytometri-analys av CD4 + T-celler ( g, dag 18) av Tcrb / d- KO-möss som genomgår passiv EAE-induktion efter att de överförts adoptivt med WT eller Tbk1- TKO MOG- primad CD4 + T-celler. ( h ) Flödescytometri-analys av CD4 + T-celler i de indikerade organen och vävnaderna från WT-möss som överfördes adoptivt (under 4 dagar) med en blandning (1: 1-förhållande) av MOG-primad WT (CMRA-märkt) och Tbk1- TKO ( CFSE-märkta) CD4 + T-celler (1: 1-förhållande). Data representerar medelvärde ± sd från två eller flera oberoende experiment. * P <0, 05; ** P <0, 01; *** P <0, 001; **** P <0, 001; NS, icke-signifikant såsom bestämdes genom tvåvägsanalys av varians med Bonferronis posttest för klinisk poänganalys av EAE och tvåparad studentparts-test för annan analys, jämför de angivna grupperna.

Bild i full storlek

T-cellmigrering till CNS befordras av den inflammatoriska CNS-mikromiljön. För att testa huruvida defekten av Tbk1 -TKO T-cellerna i CNS-infiltration berodde på de cellinriktade mekanismerna använde vi en blandad benämning för antagande av benmärg. Vi överförde adoptivt en blandning av grönt fluorescerande protein (GFP + ) WT-benmärg och GFP - Tbk1- TKO benmärg till dödligt bestrålade Rag1- KO-möss och inducerade EAE i mottagarmössen. På basis av GFP-uttryck analyserade vi frekvensen av WT- och Tbk1- TKO-T-celler i CNS och dränerande lymfkörtlar hos mottagarmössen under den tidiga effektorfasen (dag 14) av EAE-induktion. Inom samma mottagarmöss migrerade WT T-cellerna (GFP + ) effektivt till CNS, medan majoriteten av Tbk1 -TKO T-cellerna (GFP - ) bibehölls i de dränerande lymfkörtlarna (Fig. 4b). Eftersom de WT- och TBK1-bristfulla T-cellerna aktiverades under samma förhållanden tyder dessa resultat på att defekten av de TBK1-bristerna T-cellerna i infiltrering i CNS inte beror på dämpad CNS-inflammation utan snarare på grund av en cellintrisk brist.

TBK1-brist främjar retention av T-celler i lymfkörtlar

Antigenaktiverade T-celler kvarhålls initialt i dränerande lymfkörtlar för att genomgå differentiering och sedan lämna lymfkörtlarna och migrera till det perifera platsen för infektion eller inflammation 21 . Eftersom de TBK1-bristfälliga T-cellerna ackumulerades i de dränerande lymfkörtlarna under EAE-induktion (fig. 4b), undersökte vi huruvida förlusten av TBK1 påverkade T-cellutgång från lymfkörtlarna genom att använda en blandad T-cellöverföringsmetod. Vi märkte WT- och Tbk1 -TKO-naiva CD4 + T-celler med CellTracker Orange CMRA-färgämne och karboxifluoresceinsuccinimidylester (CFSE) fluorescensfärger respektive och överförde en blandning av de märkta cellerna (i förhållandet 1: 1) till WT-möss. Vi analyserade sedan fördelningen av WT- och Tbk1 -TKO-T-cellerna under en tidig fas av MOG-immunisering (dag 5). Vi upptäckte ansamlingen av Tbk1- TKO T-celler i de dränerande lymfkörtlarna med samtidig reducerad frekvens i perifert blod (Fig. 4c). Detta resultat indikerade förbättrad lymfkörtelretention av de TBK1-bristfälliga T-cellerna efter antigenstimulering. Parallellt utförde vi också konfokal avbildning för att analysera T-cellerna i både T-cellzonen och lymfkärregionen. I överensstämmelse med flödescytometri-analysresultatet (Fig. 4c) var de CFSE-märkta Tbk1- TKO T-cellerna klart rikligare än de CMRA-märkta WT-T-cellerna i T-cellzonen i den dränerande lymfkörteln (Fig. 4d, vänster). Intressant nog fann man emellertid ett signifikant lägre TKO: WT T-cellförhållande i lymfkärlsområdet jämfört med det i T-cellzoner (fig. 4d, höger; fig. 4e), i överensstämmelse med en reducerad egress av TKO T-celler genom kortikala bihålor (Fig. 4d, e). Dessa resultat indikerar att TBK1 kan reglera utgången av effektor T-celler från de dränerande lymfkörtlarna.

Eftersom TBK1-bristen endast delvis påverkade lymfkörtelutloppet från T-celler, undrade vi om Tbk1 -TKO-mössen var kompetenta i att införa immunsvar mot infektioner. I en influensavirusinfektionsmodell fann vi att lungan hos de virusinfekterade Tbk1- TKO-mössen endast hade måttligt reducerad frekvens av CD4 + och CD8 + T-celler och ökad frekvens av T-celler i de dränerande mediastina lymfkörtlarna (Kompletterande Fig. 4a). Både kroppsviktförlusten (kompletterande fig. 4b) och cytokinkoncentrationen i bronkoalveolärt lavage var jämförbara mellan WT- och Tbk1 -TKO-mössen (kompletterande fig. 4c). Dessa resultat antyder kompetenta immunsvar på influensavirusinfektion i Tbk1 -TKO-mössen.

För att förstå varför TBK1-bristen särskilt påverkade patogenesen av EAE utförde vi passiva EAE-studier. Vi isolerade T-celler från MOG-immuniserade WT- eller Tbk1 -TKO-möss och restimulerade dem in vitro med användning av MOG-peptiden. Efter expansion överförde vi adoptivt de autoimmuna WT- och Tbk1- TKO-effektor T-cellerna intravenöst (iv) till Tcrb / d -KO-möss. Intressant nog, under dessa förhållanden som skulle kringgå steget från T-cellutgång från den dränerande lymfkörteln, var de TBK1-bristfälliga T-cellerna fortfarande signifikant defekta vid induktion av EAE (fig. 4f), tillsammans med reducerat CD4-T-cellnummer i CNS och ökat CD4-T-cellantal i mjälten på dag 18 efter T-cellöverföringen (Fig. 4g). Genuttrycksanalys avslöjade att Tbk1 -TKO T-cellerna hade en måttlig reduktion i expressionen av Ninjl-genen och kompetent uttryck av flera andra celladhesionsmolekyler och kemokinreceptorer implicerade i T-cellmigrering in i CNS (kompletterande figur 5) 22, 23, 24 . För att ytterligare utvärdera mekanismen genom vilken TBK1 förmedlar CNS-infiltration av T-celler jämförde vi migrationen av WT- och TBK1-bristfälliga T-celler genom att märka de in vitro- expanderade MOG- primade WT- och Tbk1- TKO-T-cellerna med olika fluorescensfärger ( CMRA respektive CFSE) och överför dem i en blandning (1: 1-förhållande) till WT-möss. Vi analyserade sedan frekvensen för WT- och Tbk1 -TKO-T-cellerna (i samma mottagare) i blod-, lung- och lymfoida organ under den tidiga fasen (dag 4) av T-cellöverföring. Detta tillvägagångssätt bekräftade vidare defekten av Tbkl- TKO-effektor T-cellerna vid migrering till CNS (fig. 4h). Intressant nog ackumulerades Tbkl- TKO-effektor T-cellerna i de mediastinala lymfkörtlarna (fig. 4h). Det är naturligtvis känt att autoimmuna T-celler migrerar till CNS via lungan och de lungdränerande mediastina lymfkörtlarna 24 . Dessa resultat antyder att den försämrade CNS-infiltrationen av TBK1-bristfälliga autoimmuna T-celler kan involvera ökad intranodal retention i olika steg, även om involvering av TBK1 i att reglera vissa andra aspekter av T-cellmigrering är också möjligt.

TBK1 styr aktivering av AKT och mTORC1

För att förstå signalmekanismen genom vilken TBK1 reglerar T-cellshomeostas och EAE-patogenes, undersökte vi effekten av den T-cellspecifika TBK1-ablationen på aktiveringen av signalmolekyler. En slående fenotyp av Tbk1 -TKO T-cellerna var förhöjd homeostatisk aktivering av AKT (fig. 5a). Fosforyleringen av Foxo1, ett känt mål för AKT 25, var också högre i de TBK1-bristfälliga T-cellerna (Fig. 5a). Ett annat viktigt nedströmsmål för AKT är det metaboliska kinaset mTORC1 (ref. 26). Konsekvent hade de TBK1-bristfälliga T-cellerna förhöjd fosforylering av mTORC1-substratproteinet S6-kinas 1 (S6K1) såväl som S6K1-substratet S6 (fig. 5a). Däremot förändrade förlusten av TBK1 inte fosforylering av MAP-kinaser p38 och ERK (kompletterande figur 6a). Den avgörande rollen för TBK1 för att kontrollera den homeostatiska aktiveringen av AKT och mTORC1 var unik, eftersom den inte sågs med IKKε-KO T-cellerna (kompletterande figur 6b). De avreglerade signalhändelserna i Tbk1 -TKO T-cellerna berodde inte heller på deras aktiveringstillstånd, eftersom liknande resultat erhölls med både naiva och CD4 + T-celler i minnet (kompletterande figur 6c). Förlusten av TBK1 främjade också fosforylering av AKT och S6 stimulerad av anti-CD3 plus anti-CD28 (fig. 5b). Dessutom upptäckte vi hyperfosforylering av AKT såväl som S6 och S6K1 i Tbk1 -TKO T-celler som isolerades under effektorfasen för EAE-induktion (Fig. 5c). Med användning av det Cre-ER-inducerbara KO-systemet fann vi att TBK1-ablation hos vuxna möss också orsakade avvikande fosforylering av AKT och S6 i T-celler (kompletterande figur 6d), vilket ytterligare betonade en avgörande roll för TBK1 vid kontroll av aktiveringen av AKT och dess nedströmsmål, Foxo1 och mTORC1.

( a ) IB-analys av fosforylerad (P-) AKT (Ser473), Foxo1 (Thr24), S6 (Ser235 / 236), S6K1 (Thr389), såväl som deras totala proteinkontroller i CD4 + T-celler från WT och Tbk1 - TKO-möss (6 veckor gamla). ( b ) IB-analys av de indikerade fosforylerade (P-) och totala proteinerna i CD4 + T-celler aktiverade med anti-CD3 plus anti-CD28 med användning av en tvärbindningsmetod. ( c ) IB-analys av de angivna fosforylerade (P-) och totala proteinerna i CD4 + T-celler isolerade från dag 18 EAE-inducerade WT- eller Tbk1- TKO-möss. ( d ) AKT isolerades med IP från lysat av tymocyter härledda från WT- eller Tbk1- TKO-möss (6 veckor gamla), och de ubikitinerade AKT (Ub-AKT) detekterades med IB med användning av en anti-ubiquitin-antikropp som detekterade K48-länkade polyubikvitinkedjor. ( e ) IB-analys med användning av WT CD4 + T-celler, förbehandlad under 1 timme med en TBK1-hämmare, MRT67307, av lösningsmedelskontroll-dimetylsulfoxid (DMSO) och stimulerades därefter under de angivna tiderna med anti-CD3 plus anti-CD28 i närvaro av en proteinsyntesinhibitor, cykloheximid. ( f ) IB-analys av endogent AKT och aktin och exogent FLAG-TBK1 i helcellslysat av HEK293T-celler, transfekterat som angivet och därefter inkuberats under 2 timmar med DMSO eller MG132 (25 μM). En pilspets indikerar det ospecifika bandet. ( g ) IB-analys av de indikerade exogena proteinerna i helcellslosaten av HEK293-celler transfekterade med HA-AKT WT eller de indikerade punktmutanterna antingen i närvaro (+) eller frånvaro (-) av FLAG-märkt TBK1. En pilspets indikerar det ospecifika bandet. ( h ) IB-analys av helcellslysat av WT CD4 + T-celler transducerade med pMIGR1-retrovirus som kodar för WT- eller mutantformer av AKT såväl som GFP-markören. ( i ) IB (vänster) och flödescytometri (höger) analyser av milt-CD4 + T-celler från WT- eller Tbk1- TKO-möss behandlade injicerade (ip) med rapamycin under 5 dagar ( n = 5). ( j ) IB-analys av CD4 + -celler från mjälten från de indikerade musstammarna. ( k, l ) EAE-sjukdomsscore ( k ) och CD4 + T-cellantal för dränering av LN och CNS ( l, dag27) ( l ) av de angivna musstammarna, immuniserade för EAE-induktion ( n = 4). ( m ) Kvantitativ PCR (qPCR) -analys av de indikerade generna i nyligen isolerade naiva eller CD4 + T-celler från WT och Tbk1- TKO-möss ( n = 4). ( n ) S1PR1-flödescytometri-analys i minnes-CD4 + -cell i inguinal LN från WT- eller Tbk1 -TKO-möss. ( o ) qPCR-analys av KLF2 i CD4 + T-celler behandlade under 1 timme med antingen DMSO-kontroll eller hämmare för AKT (AKTi) eller PI3-kinas (LY294002). Data representerar medelvärde ± sd från två eller flera oberoende experiment. * P <0, 05; ** P <0, 01; NS, icke-signifikant såsom bestämdes genom tvåvägsanalys av varians med Bonferronis posttest för klinisk poänganalys av EAE och tvåparad studentparts-test för annan analys, jämför de angivna grupperna.

Bild i full storlek

TBK1 inducerar fosforyleringsberoende AKT-nedbrytning

Även om AKT-aktivering har studerats i stor utsträckning är hur otroligt hur detta masterkinas kontrolleras negativt. Vi fann att hyperaktiveringen av AKT i TBK1-bristfälliga T-celler var förknippad med en djup ökning av nivån av totalt AKT-protein (fig. 5a och kompletterande fig. 6b – d). Denna fenotyp berodde inte på förstärkt AKT-mRNA-uttryck (kompletterande fig. 6e), vilket indikerar en post-translationell mekanism för AKT-reglering. Vi undersökte alltså det möjliga engagemanget av ubiquitin – proteasomvägen. På grund av det låga antalet naiva T-celler i Tbk1 -TKO-mössen använde vi tymocyter för AKT-ubikvitationsanalyser. Såsom ses i perifera T-celler hade de TBK1-bristiga tymocyterna en förhöjd nivå av AKT (fig. 5d). Intressant nog genomgick AKT lysin 48-länkad polyubikitination i WT-tymocyterna, vilket reducerades drastiskt i de TBK1-bristiga tymocyterna (fig. 5d). Denna upptäckt antyder att TBK1 kontrollerar den homeostatiska nivån av AKT genom att främja ubiquitinberoende AKT-nedbrytning, vilket således förklarar ackumuleringen av AKT i de TBK1-bristfälliga T-cellerna.

Eftersom homeostasen av T-celler involverar konstant stimulering av TCR av självligander 27, frågade vi om TCR-signalen kunde stimulera AKT-nedbrytning och om denna signalhändelse reglerades av TBK1. För att undvika den homeostatiska effekten av TBK1-brist använde vi WT CD4 + T-celler. Faktum är att stimuleringen av WT CD4 + T-cellerna med anti-CD3 och anti-CD28 ledde till gradvis förlust av AKT (fig. 5e). Dessutom hämmade en liten molekylinhibitor av TBK1, MRT67307 (ref. 28) effektivt AKT-nedbrytningen (fig. 5e). Därefter använde vi en transient transfektionsmodell för att se om överuttryckt TBK1 kunde inducera AKT-nedbrytning. Faktum är att uttrycket av TBK1, men inte dess katalytiskt inaktiva mutant (K38A), orsakade drastisk förlust av endogen AKT, som blockerades av en proteasominhibit, MG132 (fig. 5f). TBK1 inducerade också den proteolytiska nedbrytningen av exogent uttryckt AKT men påverkade inte det samtransfekterade kontrollproteinet GFP (kompletterande figur 6f).

En tidigare studie antyder att de överuttryckta TBK1-fosforylaterna AKT vid treonin-195 och serin-378, men den funktionella betydelsen har inte fastställts 29 . Vårt konstaterande att TBK1 stimulerade AKT-nedbrytning fick oss att undersöka om dessa fosforyleringsställen reglerar TBK1-stabilitet. Mutation av treonin-195, eller aktiveringsslingan-fosforyleringsstället treonin-308, av AKT inhiberade endast svagt TBK1-stimulerad nedbrytning (fig. 5g). Intressant nog förhindrade mutationen av serine-378 av AKT fullständigt dess nedbrytning med TBK1 (fig. 5g). När stabilt uttryckt i T-celler visade AKT-mutanten som innehöll serin-378-mutationen också markant högre expressionsnivå (fig. 5h). Dessa resultat indikerar att den TBK1-inducerade AKT-fosforyleringen vid serin-378 spelar en viktig roll för att reglera ödet för AKT.

Funktionell betydelse av AKT-mTORC1-avreglering

Vårt konstaterande att TBK1 kontrollerar aktiveringen av AKT och mTORC1 ger molekylär insikt i den försämrade T-cell-homeostasen i Tbk1 -TKO-möss, eftersom AKT-mTORC1-signalaxeln har en avgörande roll i regleringen av T-cell-homeostas 26 . Vi fann faktiskt att behandling av Tbk1 -TKO-möss med en mTORC1-hämmare, rapamycin, blockerade den homeostatiska aktiveringen av mTORC1 och korrigerade T-cellens homeostas-fenotyp (fig. 5i).

Det är känt att aktiverade T-celler initialt nedreglerar hemreceptorer, speciellt sfingosin-1-fosfatreceptor 1 (S1PR1), och sedan återfår uttrycket av S1PR1 för att migrera ut från lymfkörtlarna 21 . Denna dynamiska förändring är kopplad med den initiala aktiveringen av AKT och den efterföljande minskningen av AKT-aktiviteten. Eftersom Tbk1 -TKO T-celler hade avvikande AKT-ackumulering och aktivering testade vi om ablationen av AKT kunde korrigera EAE-fenotypen för Tbk1 -TKO-mössen. Vi korsade Tbk1 -TKO-möss med Akt -KO-möss för att generera Akt +/– Tbk1 -TKO-möss. Intressant nog var ablation av en allel av Akt , som reducerade nivån av AKT och P-AKT i Tbk1 -TKO T-celler (fig. 5j), i stor utsträckning återställd känsligheten för Tbk1 -TKO-mössen för EAE-induktion (fig. 5k) som liksom CNS-migrationen av Tbk1 -TKO T-cellerna (Fig. 5l).

Ett kännetecken för de CNS-migrerande autoimmuna T-cellerna är den höga nivån av transkriptionsfaktorn KLF2 och dess målgen S1PR1, vars senare har blivit ett attraktivt mål för MS-terapi 24, 30, 31 . I naiva CD4 + T-celler reducerade TBK1-bristen endast måttligt expressionen av KLF2 och S1PR1 såväl som två andra T-cell-hominggener, CCR7 och CD62L (Fig. 5m). Intressant nog inhiberade emellertid TBK1-bristen uttrycket av KLF2 och S1PR1, även om endast måttligt reducerat expression av CCR7 och CD62L, i minnespopulationen av CD4 + T-celler (fig. 5m). Flödescytometri-analyser avslöjade också reducerad nivå av ytuttryck av S1PR1 i Tbk1- TKO CD4 + T-celler (fig. 5n).

Det är känt att uttrycket av KLF2 förmedlas av Foxo1, en transkriptionsfaktor som är negativt reglerad av AKT 32 . Intressant nog incubation av Tbk1 -TKO CD4 + T-celler med små molekylinhibitorer för AKT (AKTi) och dess uppströms regulator PI3 kinas (LY294002) främjade uttrycket av KLF2 (fig. 5o). Å andra sidan ökade dessa hämmare endast något uttrycket av KLF2 i WT-T-cellerna (fig. 5o), i överensstämmelse med den låga basala AKT-aktiviteten i WT-T-celler (fig. 5a). Således dämpade TBK1-bristen uttrycket av KLF2 och S1PR1, vilket i sin tur tycktes bero på den deregulerade AKT-aktiveringen. Sammantaget indikerar dessa data att den avvikande AKT-aktiveringen i TBK1-bristfälliga T-celler bidrar till deras dämpade CNS-migration och induktion av EAE.

För att undersöka TBK1: s roll i reglering av AKT-mTORC1-signalering och genuttryck i humana T-celler tystade vi uttrycket av TBK1 med användning av korta hårnål-RNA: er (shRNA) uttryckta i en lentiviral vektor. Intressant nog främjade shRNA-medierad TBK1-tystnad fosforylering av AKT såväl som AKT-mTORC1 nedströmsproteiner Foxo1 och S6 (kompletterande figur 7a). Konsekvent reducerade TBK1-nedslagningen också uttrycket av S1PR1 och KLF2 såväl som CD62L (kompletterande figur 7b). Med användning av en väldefinierad in vitro T-cellmigrationsmodell 33 fann vi att TBK1-knockdown i mänskliga CD4 + T-celler signifikant inhiberade deras förmåga att transmigrera genom en mänsklig mikrovaskulär endotelcellcell (EC) monolager (kompletterande fig. 7c). Liknande resultat erhölls när T-cellerna behandlades med en TBK1-hämmare, amlexanox (kompletterande fig. 7d).

Parallellt med de funktionella studierna analyserade vi de potentiella förändringarna av TBK1-uttryck hos MS-patienter. Våra data avslöjade att uttrycket av TBK1 ökas signifikant i den perifera mononukleära blodcellen (PBMC) hos MS-patienter jämfört med de friska donatorerna (kompletterande figur 7e). Konsekvent visade sig TBK1-uttryck också vara förhöjda (2, 41- och 1, 79-veck) i två MS PBMC-mikroarray-databaser 34, 35 . Dessa resultat antyder att TBK1 styr AKT-mTORC1 signalaxel i både murina och humana T-celler.

En TBK1-hämmare förbättrar EAE-patogenesen

Uppgifterna beskrivna ovan avslöjade inte bara en tidigare okänd signalmekanism som reglerar T-cellfunktion och CNS-inflammation men implicerade också TBK1 som ett attraktivt terapeutiskt mål för behandling av MS. För att ytterligare utvärdera det terapeutiska värdet för TBK1 testade vi effekten av den farmakologiska hämningen av TBK1 på induktionen av EAE. I detta avseende identifierade en nyligen genomförd studie den godkända terapeutiska föreningen amlexanox av Food and Drug Administration som en selektiv hämmare av TBK1 (ref. 36). Vi frågade om amlexanox kunde förbättra EAE och i så fall om det verkade genom att modulera T-cellmigrering till CNS. Vi behandlade mössen dagligen med amlexanox (via intraperitoneal (ip) injektion) under induktionen av EAE. Amlexanox-behandlingen fördröjde drastiskt början och minskade svårighetsgraden av EAE-sjukdomen (fig. 6a), vilket var förknippat med en djup minskning av antalet CD4 + och CD8 + T-celler i CNS hos de EAE-inducerade mössen (Fig. 6b). Såsom ses med TBK1-genablationen inhiberade amlexanoxbehandlingen inte T-cellutvidgning utan förorsakade snarare sekwestrering av T-celler i de dränerande lymfkörtlarna och mjälten (Fig. 6c). Dessutom visade T-cellerna som isolerades från de amlexanox-behandlade mössen avvikande aktivering av AKT och dess målprotein Foxo1 såväl som mTOCR1-vägkomponenten S6 (fig. 6d).

( a - d ) WT-möss immuniserades för EAE-induktion. Från och med 4 dagar före immuniseringen behandlades mössen dagligen (via ip-injektion) med vehikelkontroll eller TBK1-hämmaren amlexanox (25 mg per kg kroppsvikt) under 14 dagar ( n = 5). De immuniserade mössen övervakades med avseende på poängen för EAE-sjukdom ( a ) eller dödades på dag 22 efter immunisering för flödescytometrisk analys av de indikerade cellpopulationerna i CNS ( b ) och perifera lymfoida organ ( c ) eller för IB-analys av de angivna fosforylerade ( P-) och totala proteiner i milt CD4 + T-celler ( d ). ( e ) EAE-klinisk poäng av SJL.J-möss immuniserade med PLP 139–151 för att inducera den återstående återfallande EAE och behandlades sedan dagligen (via ip-injektion) med fordonskontroll eller TBK1-hämmaren amlexanox (25 mg per kg kroppsvikt) för 14 dagar från dag 23 ( n = 5). Data representerar medelvärde ± sd från två eller flera oberoende experiment. * P <0, 05; ** P <0, 01; *** P <0, 001; **** P <0, 0001; NS, non-significant as determined by two-way analysis of variance with Bonferroni's post test for EAE clinical scores analysis and two-tailed unpaired Student's t -test for other analysis, comparing the indicated groups.

Bild i full storlek

To further assess the therapeutic potential of amlexanox, we employed a remitting–relapsing EAE model, which involved the immunization of SJL mice with a peptide (139–151) derived from the proteolipid protein (PLP). As expected, the immunized SJL mice developed EAE, recovered from the disease after about 20 days and then relapsed (Fig. 6e). On day 23 after immunization, we treated the mice (via ip injection) with vehicle control or the TBK1 inhibitor amlexanox (25 mg per kg body weight) for 14 days ( n =5). Importantly, the amlexanox treatment greatly inhibited the EAE relapse (Fig. 6e). Collectively, these results highlight the potential of TBK1 as a therapeutic target for the treatment of MS. Of course, it is currently unclear whether the effect of amlexanox was solely on T cells or also on innate immune cells, such as monocytes or macrophages. Future studies will further address this question by generating myeloid cell-conditional Tbk1 -KO mice.

Diskussion

The data presented in this study establish TBK1 as a crucial signalling factor that regulates the homeostasis and inflammatory function of T cells. A prominent phenotype of the Tbk1 -TKO mice was the increased frequency of memory-like T cells and decreased frequency of naïve T cells in the lymphoid organs. Although the TBK1 deficiency promotes T-cell activation and differentiation, the Tbk1 -TKO mice are refractory to the induction of EAE, an animal model of the autoimmune neuroinflammatory disease MS.

We obtained genetic and biochemical evidences that TBK1 served as a negative regulator of AKT. T-cell-specific ablation of TBK1 caused heightened activation of AKT and its downstream targets, mTORC1 and Foxo1. The deregulated mTORC1 activation appeared to contribute to the perturbed homeostasis of TBK1-deficient T cells. We found that the injection of Tbk1 -TKO mice with an mTORC1 inhibitor could largely, although not completely, correct their abnormal phenotype in T-cell homeostasis. These data suggest that the uncontrolled mTORC1 signalling contributes to, but may not be solely responsible for, the perturbed T-cell homeostasis in Tbk1 -TKO mice. Besides mTORC1, several other factors in the related pathways, including the transcription factors Foxo1 and KLF2, are required for maintaining T-cell homeostasis 37, 38 . Indeed, the TBK1 deficiency attenuated Foxo1 activation and KLF2 expression in T cells, indicating the involvement of these transcription factors in the perturbed T-cell homeostasis in the Tbk1 -TKO mice.

Migration of autoimmune T cells from lymphoid organs to the target tissues represents a crucial and complex step in the development of autoimmunity. Newly activated T cells express low levels of the factors involved in T-cell migration, particularly the transcription factor KLF2 and its target gene product S1PR1, which is correlated with the lymphoid retention of the T cells 39 . Over time, the activated T cells differentiate into effector T cells and gradually regain the ability to express the migration-regulatory genes, which is important for the egress of T cells from the lymphoid organs. The role of KLF2 and S1PR1 in mediating T-cell migration has been directly demonstrated in a number of studies 37, 40, 41 . Our data suggest that TBK1 promotes the expression of KLF2 and S1PR1 in T cells and, thereby, facilitates the lymph node egress of T cells. We obtained genetic and pharmacological evidence that deregulated AKT activation in Tbk1 -TKO T cells contributed to the reduced expression of KLF2 and S1PR1 and attenuated migration of T cells to the CNS. Ablation of one allele of Akt in the Tbk1 -TKO largely corrected their phenotype in T-cell migration and EAE sensitivity. The transcription factor Foxo1, which is negatively regulated by AKT, has been implicated in the induction of KLF2 and other migration-regulatory genes 38, 42, 43 . We propose that TBK1 promotes T-cell migration by downregulating AKT and, thereby, maintaining a sufficient level of active Foxo1 for mediating the expression of migration genes. Indeed, we found that TBK1 deficiency causes elevated Foxo1 phosphorylation in T cells.

It is important to note that the TBK1 deficiency only partially impaired the lymph node egress of T cells. Consistently, the Tbk1 -TKO mice remained competent in mounting immune responses to influenza virus infection. This finding suggests that TBK1 may regulate additional functions of the CNS autoimmune T cells other than facilitating their exit from the draining lymph nodes. It is also possible that the complex route of autoimmune T-cell migration in EAE may contribute to the remarkable resistance of the Tbk1 -TKO mice to EAE induction. Following their exit from draining lymph nodes, CNS autoimmune T cells migrate to the CNS via the lung and the lung-draining mediastinal lymph nodes 24 . Our data suggest that the Tbk1 -TKO effector T cells not only have the tendency to be retained in the draining lymph nodes but also accumulate in the mediastinal lymph nodes. These results suggest that the impaired CNS infiltration of TBK1-deficient T cells may involve different steps of lymph node retention, although it remains possible that TBK1 may also regulate additional mechanisms of T-cell migration to the CNS.

TBK1 and its homologue IKKε are known as an innate immune kinase that mediates induction of type I IFNs 14 . Although TBK1 is thought to be functionally redundant with IKKε in innate immune cells, our data suggest that these two kinases have fundamentally different functions in T cells. While TBK1 regulates T-cell homeostasis and mediates T-cell migration into the CNS, IKKε is dispensable for these biological functions. IKKε is also dispensable for the control of AKT-mTORC1 signalling axis. Nevertheless, like TBK1, IKKε is activated by the T-cell activation signals. Further studies are required to examine whether IKKε regulates any aspects of T-cell functions. The functional differences between TBK1 and IKKε have also been shown in B cells, in which TBK1, but not IKKε, regulates antibody class switching to IgA 44 .

Studies using immortalized mouse embryonic fibroblast and cancer cell lines suggest a positive role of TBK1 in the regulation of AKT 29, 45 . TBK1 phosphorylates AKT at several residues, including threonine-195 and serine-378, although the functional significance has not been defined 29 . Our current work provides the first evidence for the in vivo role of TBK1 in the regulation of AKT. Our data clearly demonstrated a negative role for TBK1 in AKT regulation. TBK1 does not seem to inhibit the catalytic activation, but rather controls the fate, of AKT. In TBK1-deficient T cells, the steady level of AKT is drastically elevated, which contributes to the aberrant AKT activity in naïve and effector T cells. We have obtained biochemical evidence that the serine-378 phosphorylation site of AKT is crucial for TBK1-stimulated AKT degradation.

Our work not only demonstrated a novel signalling mechanism that regulates T-cell homeostasis and EAE pathogenesis but also have profound implications for MS therapy. Regarding the human relevance of our findings, we found that TBK1 knockdown in human PBMCs causes hyperactivation of AKT-mTORC1 signalling and reduced expression of the T-cell homing genes KFL2 and S1PR1. Furthermore, TBK1 knockdown or pharmacological inhibition attenuates the transmigration of human CD4 + T cells across a human brain microvascular endothelial monolayer in vitro . Our finding that TBK1 ablation does not affect T-cell activation or immune responses against flu viral infection, but attenuates EAE induction, makes TBK1 an attractive therapeutic target to be exploited in the treatment of MS. We found that amalexanox, a Food and Drug Administration-approved drug that selectively inhibits TBK1 (ref. 36), greatly attenuated the induction of EAE and inhibited the disease relapse in a remitting–relapsing model of EAE. Amlexanox also inhibited human T-cell migration in vitro . Of note, the mode of action of TBK1 differs substantially from that of S1PR1. First of all, TBK1 appears to regulate the re-expression of S1PR1 following its downregulation in activated T cells, but is dispensable for the overall expression of S1PR1. Thus, unlike the S1PR1 ablation, the TBK1 deficiency does not influence the homing of naïve T cells or the thymic emigration of newly generated T cells. Furthermore, the TBK1 deficiency only partially inhibits the expression of S1PR1 and the egress of effector T cells from the lymph nodes. Consistently, the loss of TBK1 does not appreciably compromise immune responses against influenza virus infection. These findings along with the fact that amlexanox is a relatively safe drug that has been used for many years in the clinic indicate that amlexanox may be an attractive compound to be evaluated in MS clinical trials.

metoder

Möss

The Tbk1 -flox mice were generated in B6 × 129 mixed genetic backgrounds 44 and further backcrossed to the B6 mice for four generations. To generate T-cell-conditional Tbk1 -KO mice, Tbk1 -flox mice 44 were crossed with CD4-Cre transgenic mice (B6 genetic background, Jackson Laboratories), producing Tbk1 +/+ CD4-Cre (named WT) and Tbk1 fl/fl CD4-Cre (named Tbk1 -TKO mice) mice. Tbk1 -flox mice were also crossed with Rosa26-Cre-ER mice (B6 genetic background, Jackson Laboratories) and the progeny Tbk1 +/+ Rosa26-Cre-ER and Tbk1 fl/fl Rosa26-Cre-ER mice were injected ip with tamoxifen (2 mg per mouse) in corn oil daily for four consecutive days to induce Cre function. The tamoxifen-treated Tbk1 +/+ Rosa26-Cre-ER and Tbk1 fl/fl Rosa26-Cre-ER mice were named WT-ER and Tbk1 -ER mice, respectively, and used 2 weeks after the treatment. Carma1 -KO mice (B6 × 129 genetic background) were provided by Dr Josef M. Penninger (Austrian Academy of Sciences) 46 . Mice with loxP-flanked allele encoding IKKβ (IKK2) or NEMO alleles were provided by Dr Manolis Pasparakis (University of Cologne) 47 . These mice were crossed with CD4-Cre mice to generate the T-cell-conditional IKKβ KO ( IKKβ -TKO) and NEMO KO ( NEMO -TKO) mice. IKKε -KO, B6.SJL (CD45.1 + ), C57BL/6, Rag1 -KO and TCRβ / δ KO mice were from Jackson Laboratory. Experiments were performed with age-matched mice. Mice were maintained in a specific pathogen-free facility of The University of Texas MD Anderson Cancer Center, and all animal experiments were done in accordance with protocols approved by the Institutional Animal Care and Use Committee of the University of Texas MD Anderson Cancer Center.

Celllinjer

The NEMO-deficient JM4.5.2 cell line and its NEMO-competent control J.SVT35 are Jurkat derivatives 18 . The CARMA1-deficient JPM50.6 mutant cell line and its parental Jurkat cell line were provided by Dr Xin Lin (UT MD Anderson Cancer Center) 17 .

Plasmids and antibodies and reagents

The pcDNA expression vector encoding haemagglutinin (HA)-tagged human AKT1 was provided by Dr Keqiang Ye (Emory University). pMIGR1-hAKT was generated by inserting human AKT1 cDNA into the EcoRI and BglII sites of pMIGR1 vector, and the AKT mutants (T195A, T 308A, S378A) were created by site-directed mutagenesis. Flag-tagged TBK1 and its catalytically inactive mutant, K38A, were provided by Dr Chen Wang (Shanghai Institutes for Biological Sciences). GST-IκBα (amino acids 1–54 of IκBα) was as described 48 and GST-IRF3 (amino acids 380–427) was provided by Dr Rongtuan Lin (McGill University).

Functional grade anti-mouse (m) CD3ε (145-2C11) and anti-mCD28 (37.51) antibodies and blocking antibodies for mIFN-γ (XMG1.2) and mIL-4 (11B11) were from eBioscience. Antibodies for AKT1 (B-1, 1:1, 000), phospho-ERK1/2 (E-4, 1:1, 000), ERK1/2 (K-23, 1:1, 000), p38 (H-147, 1:1, 000), and GFP (B-2, 1:1, 000) were from Santa Cruz Biotechnology. Anti-IKKi (IKKε, 1:1, 000), anti-Actin (C-4, 1:5, 000) and horseradish peroxidase-conjugated anti-Flag (M2, 1:10, 000) were from Sigma-Aldrich. Antibodies for phospho-TBK1 Ser172 (D52C2, 1:1, 000), phospho-AKT1 Ser473 (D9E, 1:1, 000), phospho-S6K1 Thr389 (1A5, 1:1, 000), phospho-S6 Ser235/236 (D57.2.2E, 1:1, 000), phospho-FoxO1 Thr24/FoxO3a Thr32 (1:1, 000), phospho-p38 Thr180/Tyr182 (3D7, 1:1, 000), TBK1, S6K1 (49D7, 1:1, 000), S6 (54D2, 1:1, 000) and FoxO1 (C29H4, 1:1, 000) were from Cell Signaling Technology. Horseradish peroxidase-conjugated anti-haemagglutinin (HA-7, 1:3, 000) was from Roche. Anti-K48-Ubiquitin (Apu2, 1:1, 000) was from Millipore.

Fluorescence-labelled antibodies for murine (m) CD4 (L3T4, 1:300), mCD8 (53-6.7, 1:300), mCD3 (145-2C11, 1:300), CD44 (IM7, 1:300), CD62L (MEL-14, 1:300), mTCRβ (H57-597, 1:300), mCD45.1 (A20, 1:300), mCD45.2 (104, 1:300), mThy1.1 (HIS51, 1:300), IL-17A (eBio17B7, 1:300), and IFN-γ (XMG1.2, 1:300) were purchased from eBioscience. Annexin V was from BD. The fluorescence-labelled phospho-specific antibodies were all from Cell Signaling Technology.

The AKT inhibitor 1/2 was from Calbiochem, the PI3 kinase inhibitor LY294002 was from Selleck, the TBK1 inhibitor MRT673037 was from Chemexpress, the TBK1 inhibitor amlexanox was from Cayman Chemical and the protein synthesis inhibitor cycloheximide was from Sigma-Aldrich.

Flow cytometry analysis and cell sorting

Single-cell suspensions of splenocytes and lymph node cells were subjected to flow cytometry and cell sorting as previously described 49 using a FACSAria (BD Biosciences). For intracellular cytokine staining (ICS) assays, T cells isolated from the spleen, draining lymph nodes or CNS (brain and spinal cord) of immunized mice or from in vitro cultures were stimulated for 4 h with PMA (50 ng ml −1 ) and Ionomycin (500 ng ml −1 ) in the presence of monensin (10 μg ml −1 ). The stimulated cells were fixed in 2% paraformaldehyde and permeablized in 0.5% saponin and then subjected to cytokine staining flow cytometry analyses.

In vivo inhibition of mTORC1

Mice were injected daily (ip) with the mTORC1 inhibitor rapamycin (3 mg per kg body weight) or solvent control (1% ethanol in PBS) for 5 days and then killed for experiments.

Influenza viral infection

Influenza virus A/PR8 (H1N1) was provided by Dr Brian E. Gilbert (Baylor College of Medicine). For influenza infection, mice were first anaesthetized and then inoculated intranasally with 50 μl of influenza virus A/PR8 diluted in DMEM medium. Control mice were inoculated with 50 μl DMEM as control. Body weight was monitored every other day for 8 days. On day 8, bronchoalveolar lavage fluid was collected in anaesthetized mice. Then, 500 μl cold PBS was instilled into the lungs through the trachea and aspirated back. After collecting bronchoalveolar lavage fluid, mice were killed for cell distribution analysis.

Induction and evaluation of EAE

The encephalitogenic peptide of MOG (residues 35–55, Met-Glu-Val-Gly-Trp-Tyr-Arg-Ser-Pro-Phe-Ser-Arg-Val-Val-His-Leu-Tyr-Arg-Asn-Gly-Lys) and the encephalitogenic peptide of myelin PLP (residues 139–151, His-Cys-Leu-Gly-Lys-Trp-Leu-His-Pro-Asp-Lys-Phe) were purchased from Genemed Synthesis Inc. (San Francisco, CA, 95% purity). To induce acute EAE, mice were injected subcutaneously (in the back region) with 200 μg of the MOG 35–55 peptide in CFA containing 5 mg ml −1 heat-killed Mycobacterium tuberculosis (H37Ra strain; BD Diagnostics, Franklin Lakes, NJ). To induce relapse EAE, SJL.J mice were immunized with 150 μg of PLP 139–151 in CFA containing 5 mg ml −1 heat-killed Mycobacterium tuberculosis . For both types of induction, on the day of immunization and 48 h later, the mice were also injected iv with Pertussis toxin (200 ng per mouse; List Biological Laboratories, Campbell, CA) in PBS. Mice were examined daily for EAE disease symptoms, which were scored using a standard method: 0, no clinical signs; 1, limp tail; 2, paraparesis (weakness, incomplete paralysis of one or two hind limbs); 3, paraplegia (complete paralysis of two hind limbs); 4, paraplegia with fore limb weakness or paralysis; and 5, moribund state or death. The EAE scores were assessed without group allocation information.

For amlexanox treatment, mice were ip injected with amlexanox (25 mg per kg body weight) or vehicle (dimethylsulphoxide 50% and corn oil 50%) control daily for total of 14 days. Mice were randomly selected for receiving amlexanox treatment.

For passive EAE, WT and Tbk1 -TKO mice were immunized with MOG 35–55 peptide for 10 days. Draining LN and spleen cells were then isolated and in vitro expanded for 72 h in the presence of 30 μg ml −1 MOG 35–55 peptide and Th17-differentiation agents (10 μg ml −1 anti-IFNγ, 10 ng ml −1 IL-1β and 10 ng ml −1 IL-23). CD4 + T cells were purified and adoptively transferred into irradiated (500 rads) recipient mice to for passive EAE induction.

Analysis of in vivo T-cell differentiation and CNS infiltration

At the indicated times after MOG 35–55 immunization, the mice were killed for splenocyte preparation and CNS infiltration analysis. CD4 + T cells were isolated from the splenocytes using magnetic beads (Invitrogen) and subjected to ICS as described above. For the preparation of CNS lymphocytes, brains and spinal cords were excised and dissociated for 1 h at 37 °C by digestion with collagenase IV (0.5 mg ml −1 ; Invitrogen) and DNase I (10 μg ml −1 ; Roche, Indianapolis, IN) in RPMI medium. Dispersed cells were passed through a 40-μm nylon mesh and collected by centrifugation. The cells were then resuspended in RPMI medium, layered onto a Percoll density gradient (Biochrom, Berlin, Germany) and centrifuged for 30 min (625 g , 22 °C). CNS lymphocytes were isolated by collection of the interphase fraction between 30 and 70% Percoll. After intensive washing in Hanks balanced-salt solution, cells were analysed by flow cytometry.

Histologi och immunohistokemi

We dissected spinal cords from mice transcardially perfused with 4% (w/v) paraformaldehyde and postfixed them overnight. We then stained the paraffin-embedded sections (8 μm) of spinal cords with haematoxylin and eosin or Luxol Fast Blue staining. Cryostat sections (7–8 μm) of lymph nodes were fixed and stained with biotinylated anti-CD4 (1:100; BD Biosciences) at 4 °C overnight, followed by HRP-conjugated streptavidin (Thermo Scientific) at room temperature for 1 h. Slices were then developed with peroxidase substrate kit (Vector).

Mixed bone marrow chimera

Rag1 -KO mice were subjected to lethal-dose (992 rads) irradiation and, 1 day later, were adoptively transferred with bone marrow cells harvested from the tibiae and femurs of the indicated mice. For mixed bone marrow transfers, an equal number (6.4 × 10 6 ) of bone marrows from the CD45.1 + B6.SJL and the CD45.2 + WT or Tbk1 -TKO mice or from the GFP + WT and the GFP Tbk1 -TKO mice were mixed and injected iv into the irradiated Rag1 -KO mice. After 6 weeks, the resulting chimeras were either directly analysed or subjected to EAE induction.

Adoptive transfer of T cells for homing studies

WT and Tbk1 -TKO T cells were incubated at 37 °C for 15 min with 1 mM CFSE and 5 mM CMRA (Molecular Probes), respectively, according to manufacturer's protocol. The differentially labelled WT and Tbk1 -TKO T-cell preparations were mixed at 1:1 ratio (5 × 10 6 cells each) and injected iv into the indicated recipient mice, followed by immunizing the mice with MOG 35–55 peptide. Lymphatic vessels and the draining inguinal lymph nodes were labelled in vivo by injecting mice (subcutaneous) with 5 μg of anti-mouse LYVE-1-AF647 antibody in 100 μl PBS in the flank 24 h before imaging. For static imaging, inguinal LNs were excised, fixed in 3% paraformaldehyde PBS and cut in half. Each half lymph node was whole-mounted on a cover slip imaged using Leica SP5 RS AOBS confocal microscope with a × 20 NA0.75 objective and silicon immersion. Three-dimensional image stacks were acquired with 4 μm z -spacing. Three-dimensional analysis was performed using Imaris 7.7 software.

T-cell purification and in vitro treatments

CD4 + T cells were purified from splenocytes with anti-CD4-conjugated magnetic beads (Invitrogen). Inhibitor studies were carried out by culturing the cells in 24-well plates (4 × 10 6 cells per well) in the presence of AKT1/2 inhibitor (AKTi, 1 μM), the PI3 kinase inhibitor (LY294002, 50 μM) or the TBK1 inhibitor (MRT67307, 2 μM). For ELISA and proliferation assays, naïve CD4 T cells were stimulated in replicate wells of 96-well plates (1 × 10 5 cells per well). Culture supernatants were analysed by ELISA (eBioScience), and cells were pulse-labelled for 6 h with [ 3 H]thymidine for proliferation assays.

For in vitro CD4 + T-cell differentiation assays, naïve CD4 + T cells (CD4 + CD25 CD44 lo CD62L hi ) were sorted from splenic CD4 + T cells, prepared using a CD4 T-cell Isolation Kit (Miltenyi Biotec, Auburn, CA) and stimulated with plate-bound anti-CD3 and anti-CD28 under Th0 (5 μg ml −1 anti-IL-4, 5 μg ml −1 anti-IFN-γ), Th1 (10 ng ml −1 IFN-γ, 10 ng ml −1 IL-12, 5 μg ml −1 anti-IL-4) or Th17 (20 ng ml −1 IL-6, 5 ng ml −1 TGF-β, 5 μg ml −1 anti-IL-4, 5 μg ml −1 anti-IFN-γ) conditions. After the indicated times, the cells were subjected to ICS to quantify the production of their signature cytokines.

Retroviral and lentiviral infections

Retroviral particles were prepared using the indicated pMIGR1-GFP-based expression vectors, as previously described 50 . For the production of lentiviral particles, HEK293T cells were transfected (by calcium method) with pLKO.1 lentiviral vectors encoding shRNAs for either the control luciferase protein or TBK1 along with the packaging vectors psPAX2 and pMD2. Naive CD4 + T cells were activated with plate-bound anti-CD3 (1 μg ml −1 ) plus anti-CD28 (1 μg ml −1 ) in 24-well plates for 36 h and then infected with retroviruses. After 48 h, the transduced cells were either enriched by flow cytometric cell sorting (based on GFP expression) for in vitro assays or directly transferred into T-cell-deficient mice for in vivo assays.

PBMCs were isolated from human whole blood samples (purchased from The Gulf Coast Regional Blood Center) by Ficoll density gradient centrifugation. The cells were activated for 24 h with anti-CD3 plus anti-CD28 and then infected with the control or TBK shRNA lentiviral particles. Following infection, the infected cells were selected by culturing the cells in the presence of puromycin for 48 h. The use of human blood samples was approved by the Institutional Review Board for Human Research at MD Anderson Cancer Center.

In vitro human T-cell migration assays

In vitro T-cell migration assays were performed using a 24-well plate Boyden chamber essentially as previously described 33 . We seeded 1 × 10 5 primary human brain microvascular ECs (ACBRI 376) on top of a 3-μm pore size membrane in endothelial cell culture media. After 5 days of cultivation, the cells formed a confluent monolayer. At that point, the ECs were treated for 24 h with 100 ng ml −1 of recombinant human IL-17 (R&D Systems). The next day, ECs were washed and a suspension of 1 × 10 6 CD4 + human T cells was loaded in the upper chamber. The migration ability of T cells was assessed by counting the absolute number of T cells that transmigrated to the lower chamber after 18 h.

Immunoblot and kinase assays

For protein phosphorylation analysis and kinase assays, purified T cells were stimulated by a crosslinking method 49 . In brief, the cells were incubated on ice with anti-CD3 (2 μg ml −1 ) and anti-CD28 (2 μg ml −1 ), followed by crosslinking with goat anti-hamster Ig (25 μg ml −1 ) for different time periods at 37 °C and then immediately lysed in a kinase cell lysis buffer supplemented with phosphatase inhibitors. For IB analyses using transiently transfected cells, HEK293T cells were transfected using calcium method and cultured for 48 h. The cells were either treated as indicated or directly collected for lysate preparation. IB analyses were performed using antibodies that detect phosphorylated AKT (Ser473, 1:1, 000), Foxo1 (Thr24, 1:1, 000), S6 (Ser235/236, 1:1, 000), S6K1 (Thr389, 1:1, 000), p38 (Thr180/Tyr182, 1:1, 000) and ERK1/2 (Tyr204, 1:1, 000), or their total protein controls. In vitro kinase assays were as described 51 .

For ubiquitination assays, thymocytes were isolated from young (6 weeks old) WT or Tbk1 -TKO mice and immediately lysed in RIPA buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% (v/v) Nonidet P-40, 0.5% (v/v) sodium deoxycholate and 1 mM EDTA) supplemented with 4 mM N -ethylmaleimide. Lysates were immediately boiled for 5 min in the presence of 1% SDS and then diluted 10 times with RIPA buffer. Ubiquitinated AKT was isolated by immunoprecipitation using anti-AKT and detected by IB using an anti-ubiquitin antibody that specifically recognizes K48 ubiquitin chains.

Full size images are presented in Supplementary Figs 8–11.

Kvantitativ PCR i realtid

RNA was extracted with TRIzol reagent (Sigma) from either mouse T cells or human PBMCs derived from healthy donors or relapsing-remitting MS patients. Specimen collection was approved by the Committee for the Protection of Human Subjects of the University of Texas Health Science Center at Houston, and informed consent was obtained from all subjects. The RNA samples were subjected to quantitative PCR analyses using the SYBR regent (Bio-Rad). The expression of individual genes was calculated by a standard curve method and was normalized to the expression of Actb. The gene-specific primer sets used (all for mouse genes) were as follows: CCR7, 5′- GCACCATGGACCCAGGGAAACC -3′ and 5′- AGTCATCGGTGACCTCATCTTGGCA -3′; KLF2, 5′- TATCTTGCCGTCCTTTGCCA -3′ and 5′- TTTAGGTCCTCATCCGTGCC -3′; CD62L, 5′- AACGATGACGCCTGTCACAA -3′ and 5′- GTTTCCACACATTCTCCACGG -3′; S1pr1, 5′- GGTGTAGACCCAGAGTCCTGC -3′ and 5′- AGAGGCCTCCGAGAAACAGC -3′; AKT1, 5′- AAGAAGGAGGTCATCGTCGC -3′ and 5′- CTTGAGGGCCGTAAGGAAGG -3′; Itga4, 5′- AAGCATCCCTGGCCACTAC -3′ and 5′- GAGCGCCCCAAGAGATGAAG -3′; Itgb1, 5′- AACTTGTTGGTCAGCAACGC -3′ and 5′- AGCCAATCAGCGATCCACAA -3′; Ninj1, 5′- AGTCGGGCACTGAGGAGTAT -3′ and 5′- TACATTGATGGGCCGGTTCC -3′.

Statistisk analys

For the EAE clinical scores, differences between groups were evaluated by two-way analysis of variance with Bonferroni's post test. Other statistical analyses were performed by two-tailed unpaired t -test using the Prism software. P values less than 0.05 were considered significant and the level of significance was indicated as * P <0.05, ** P <0.01, *** P <0.001 and **** P <0.0001.

In our animal studies, three to four mice are required for each group based on our calculation to achieve a 2.3-fold change (effect size) in two-tailed t -test with 90% power and a significance level of 5%. All statistical tests justified as appropriate and the data meet the assumptions of the tests. The variance is similar between the groups that are being statistically compared.

Ytterligare information

How to cite this article: Yu, J. et al . Regulation of T-cell migration by the kinase TBK1 during neuroinflammation. Nat. Commun. 6:6074 doi: 10.1038/ncomms7074 (2015).

Kompletterande information

PDF-filer

  1. 1.

    Kompletterande information

    Supplementary Figures 1-11

kommentarer

Genom att skicka en kommentar samtycker du till att följa våra villkor och gemenskapsriktlinjer. Om du finner något missbruk eller som inte överensstämmer med våra villkor eller riktlinjer ska du markera det som olämpligt.