Pik3ca mutationsanalys hos kinesiska patienter med kirurgiskt resekterad livmoderhalscancer | vetenskapliga rapporter

Pik3ca mutationsanalys hos kinesiska patienter med kirurgiskt resekterad livmoderhalscancer | vetenskapliga rapporter

Anonim

ämnen

  • biomarkörer
  • Livmoderhalscancer
  • Prognostiska markörer
  • Translational research

Den här artikeln har uppdaterats

Abstrakt

Syftet med denna studie var att utvärdera den klinikopatologiska och prognostiska relevansen av PIK3CA- mutationer hos kinesiska patienter med kirurgiskt resekterad livmoderhalscancer. PIK3CA- mutationer screenades i 771 prov på livmoderhalscancer med användning av omvänd transkriptionspolymeraskedjereaktion och Sanger-sekvensering. Totalt innehöll 13, 6% (105 av 771) patienter icke-synonyma PIK3CA- mutationer. Patienter med PIK3CA- mutationer var äldre än patienter med vildtyp PIK3CA (medelålder: 50, 7 år mot 47, 0 år, P <0, 01). PIK3CA- mutationer observerades oftare hos postmenopausala patienter än hos premenopausala patienter (19, 6% mot 10, 2%, P <0, 01). PIK3CA- mutationer var vanligare i skvamcellcancer än i icke-skvamösa tumörer (15, 3% mot 7, 3%, av P <0, 01). 3-årigt återfallsfri överlevnad var 90, 2% för PIK3CA- mutanta patienter och 80, 9% för PIK3CA-vildtypspatienter (P = 0, 03). PIK3CA- mutation bekräftades som en oberoende prediktor för bättre behandlingsresultat i multivariata analyser (HR = 0, 54, 95% CI: 0, 29–0, 99, P = 0, 048). PIK3CA- mutationer var signifikant associerade med mindre avlägsna metastaser (mutanttyp: 8/105, vildtyp: 98/666, p = 0, 048). Således hade patienter med mutant PIK3CA distinkta egenskaper i ålder, menopausal status och histologisk subtyp och hade bättre behandlingsresultat och mindre avlägsna metastaser efter kirurgisk baserad multimodal terapi.

Introduktion

Cervical cancer är den åttonde dödligaste cancern och ansvarar för över 20 000 dödsfall i Kina årligen 1 . Trots betydande förbättringar i screening, diagnos och terapi av livmoderhalscancer under det senaste decenniet har framstegen i hanteringen av avancerad / återkommande livmoderhalscancer undertryllt, eftersom den övergripande medianöverlevnaden hos patienter med avancerad / återkommande livmoderhalscancer är mellan 10 och 13 månader .

Gener involverade i PI3K- vägen representerar potentiella terapeutiska mål för cancer, och PIK3CA- mutationsstatus kan vara användbar som en biomarkör för målinriktad terapi av livmoderhalscancer. Den ofta muterade och konstitutivt aktiverade PI3K-vägen är involverad i patogenesen för olika humana cancerformer. PI3K- vägen är ett attraktivt cancerterapeutiskt mål. PI3K- väghämmare, såsom buparlisib, everolimus och temsirolimus, har visat klinisk effekt i flera olika cancerformer 3, 4, 5, 6 . PIK3CA är en av de vanligaste muterade generna förknippade med livmoderhalscancer 7 . De flesta PIK3CA- mutationer som finns i livmoderhalscancer förekommer i den spiralformade domänen (exon 9), medan ett fåtal PIK3CA- mutationer har rapporterats påverka kinasdomänen (exon 20) 8 . Prekliniska och kliniska studier har visat att PIK3CA- mutationer kan förutsäga tumörrespons på PI3K- väghämmare 9, 10, 11, 12 . Därför är identifiering och karakterisering av livmoderhalscancerpatienter med mutant PIK3CA viktiga för att utforma kliniska prövningar som undersöker PI3K- väghämmare.

Emellertid har klinikopatologiska egenskaper och prognostiska effekter av PIK3CA- muterad livmoderhalscancer inte varit väl etablerade. Det är nödvändigt att utföra PIK3CA- mutationsanalyser i en stor kohort patienter med livmoderhalscancer. I denna studie undersökte vi därför den klinikopatologiska och prognostiska relevansen av PIK3CA- mutationer i en stor kohort av kinesiska patienter med kirurgiskt resekterad livmoderhalscancer.

Resultat

PIK3CA- mutation vid livmoderhalscancer

Prevalensen av PIK3CA- mutationer i vår kohort av 771 patienter med FIGO-stadium IB / IIA livmoderhalscancer bestämdes genom RT-PCR-baserad direkt sekvensering. Nonsynonyma PIK3CA- mutationer hittades i 105 fall (13, 6%), och alla dessa mutationer var bassubstitutioner. Tio mutationer inträffade i den spiralformade domänen (HD), medan 95 mutationer inträffade i kinasdomänen (KD). Inga tumörer innehöll mutationer i både HD och KD. Totalt inträffade 94, 3% (99) av de 105 mutationerna vid tidigare identifierade hotspots, inklusive 62 aminosyrasubstitutioner vid rest 545, 32 aminosyrasubstitutioner vid rest 542 och 5 aminosyrasubstitutioner vid rest 1 047. De vanligaste mutationerna var E545K och E542K, som båda påverkar exon 9, som hittades i 59 respektive 32 prover. H1047R-mutation, som har rapporterats förutsäga ett ökat svar på PI3K / AKT / mTOR signalvägsinhibitorer, hittades i 4 fall 13 . Flera sällsynta icke-synonyma bassubstitutioner identifierades i vår studie, varav några har rapporterats i katalogen över Somatiska mutationer i cancer (COSMIC) databas. Två mutationer som identifierats i vår studie rapporterades inte tidigare. Hundra mutationer (95, 2%) erkändes som aktiverande mutationer, medan effekterna av de återstående fem mutationerna är okända (tabell 1).

Full storlek bord

Klinikopatologisk förening av PIK3CA- mutationer

De 771 patienterna i vår studie omfattade 606 (78, 6%) patienter med skivepitelcancer (SCC), 101 (13, 1%) patienter med adenokarcinom (ACS), 44 (5, 7%) patienter med adenosquamous karcinom (ASC) och 20 (2, 6%) ) patienter med andra sällsynta histopatologiska subtyper. Tvåhundra två (26, 2%) patienter presenterade med bäcken- eller paraaortisk lymfkörtelmetastas under patologisk undersökning av de kirurgiska proverna. Fem hundra fyrtio (70, 0%) patienter genomgick postoperativ strålterapi eller kemoradioterapi för en hög risk för återfall.

Patientens ålder, menopausal status och histologiska subtyper var starka prediktorer för PIK3CA- mutationsstatus. Patienter med PIK3CA- mutationer var äldre än patienter med vildtyp PIK3CA (medelvärde 50, 7 mot 47, 0 år; P <0, 01) (tabell 2). PIK3CA- mutationer identifierades hos 23, 5% av patienterna i åldern ≥60 år, 17, 5% av patienterna mellan 50 och 59 år, 10, 9% av patienterna i åldrarna 40 till 49 år och 8, 5% av patienterna under 40 år. Denna trend var signifikant annorlunda jämfört med PIK3CA vildtypskohort (P <0, 01). PIK3CA- mutationer observerades oftare hos postmenopausala patienter än hos premenopausala patienter (19, 6% mot 10, 2%, P <0, 01). Dessutom inträffade PIK3CA- mutationer oftare i skvamösa cellkarcinom än i icke-skvamösa tumörer (15, 3% mot 7, 3%, P = 0, 01). I denna studie korrelerade inte PIK3CA- mutation med andra klinikopathonogiska särdrag, såsom kliniskt FIGO-steg, nodmetastas, tumörstorlek, myometrial invasion, LVSI och parametrial involvering (tabell 2).

Full storlek bord

Prognostisk roll för PIK3CA- mutation

Vid medianuppföljningen på 38 månader (intervall 1-59 månader) upplevde 142 patienter avlägsna metastaser (n = 106) eller återkommande bäcken (n = 36). PIK3CA- mutationer var signifikant associerade med avlägsna metastaser (mutanttyp: 8/105, vildtyp: 98/666, p = 0, 048), medan sambandet mellan PIK3CA- mutationsstatus och bäckenåterfall inte bekräftades i denna kohort av patienter ( mutanttyp: 3/105, vildtyp: 33/666, p = 0, 459).

Univariat analys avslöjade ett slående samband mellan PIK3CA- mutationer och patientens överlevnad. Patienter med mutant PIK3CA visade ett bättre behandlingsresultat än patienter med vildtyp PIK3CA . Den 3-åriga återfallsfri överlevnad (RFS) var 90, 2% för PIK3CA- mutanta patienter och 80, 9% för PIK3CA- vildtypspatienter (P = 0, 03) (fig. 1A och tabell 3). Våra multivariata analyser avslöjade att PIK3CA- mutation i livmoderhalscancer var en oberoende prediktor för bättre RFS (HR = 0, 54, 95% CI: 0, 29–0, 99, P = 0, 048) (tabell 3).

Image

Återfallsfri överlevnad (RFS) enligt PIK3CA-mutationsstatus hos patienter med livmoderhalscancer (CC) (A), patienter med skivepitelcervcancercancer (SCC) (B) och patienter som accepterar strålbehandling efter operation (C).

Bild i full storlek

Full storlek bord

För att utesluta förvirrande effekter associerade med histologiska subtyper genomfördes en överlevnadsanalys hos patienter med skivepitelcancer. En liknande dikotomiserad RFS-trend observerades enligt PIK3CA- mutationsstatus hos patienter med skivepitelcancer; skillnaden nådde emellertid inte statistisk signifikans (3-RFS: 91, 3% för mutant PIK3CA mot 83, 5% för vildtyp PIK3CA , P = 0, 07), vilket kan bero på den korta uppföljningstiden och det begränsade antalet patienter som upplever återfall av sjukdomar (Fig. 1B). Vi observerade inte tillräckligt återkommande fall (2 återfall i 12 fall med PIK3CA- mutationer) för att effektivt utvärdera sambandet mellan PIK3CA- mutationsstatus och RFS i undergrupperna av patienter med icke-skiveformiga celltumörer (visas i kompletterande figur S1A).

En överlevnadsanalysanalys utfördes hos 540 patienter som genomgick postoperativ strålbehandling. I denna grupp av patienter observerades bättre behandlingsresultat hos patienter med mutant PIK3CA än hos patienter med vildtyp PIK3CA (3-årigt RFS: 89, 1% mot 76, 0% P = 0, 02). Hos patienter som inte fick adjuvansbehandling observerades ingen signifikant skillnad i den 3-åriga RFS baserat på närvaron eller frånvaron av PIK3CA- mutation (visas i kompletterande figur S1B).

För att undersöka vilka specifika mutationer i PIK3CA som verkligen skulle vara användbara för prognos, delades alla PIK3CA- mutanter in i tre grupper enligt olika muterade positioner av aminosyrarester (pos.542, pos.545 och andra positioner). Liknande trender för RFS observerades i de tre undergrupperna av patienter, medan endast undergruppen av patienter med mutationer på pos.542 bekräftades ha bättre RFS än patienterna med bred typ PIK3CA (p = 0, 025). Skillnaderna i RFS mellan patienterna med mutationer på de andra positionerna och de med bred typ nådde inte statistisk betydelse förmodligen på grund av begränsade fall (p = 0, 366 för pos. 545 och p = 0, 379 för andra positioner, kompletterande figur S2A). Vidare delades PIK3CA- mutationer i enlighet med olika exoner (exon 9 och exon 20). Liknande trender för RFS observerades i de två undergrupperna. Emellertid hade endast patienter med mutationer i exon 9 bättre överlevnad än patienterna med bred typ (p = 0, 040). Skillnaden mellan undergrupperna med mutationer i exon 20 och utan mutationer nådde inte statistisk betydelse förmodligen på grund av begränsat fallantal (p = 0, 443, visat i kompletterande figur S2B).

Diskussion

Mutationsstatusen i PIK3CA- genen kan användas som en målinriktad biomarkör för patienter med livmoderhalscancer. De klinikopatologiska och prognostiska egenskaperna hos PIK3CA- mutationer i tumörer förblir oöverträdande. Även om flera tidigare studier har försökt undersöka denna förening 14, 15, 16, 17, 18, är de flesta av dessa studier underpowered för robusta statistiska analyser på grund av liten provstorlek (mindre än 200 fall), urvalsbias eller brist på kontroll för förvirrande faktorer. Vår studie är den första stora kohortstudien som undersökte den klinikopatologiska och prognostiska relevansen av PIK3CA- mutationer hos patienter med kirurgiskt resekterad livmoderhalscancer.

Prevalensen (13, 6%) av PIK3CA- mutationer i vår studie överensstämmer med den som rapporterats i COSMIC-databasen (10%) såväl som i en full exome sekvenseringsstudie (14%) 7 . Men vår rapporterade prevalens är också betydligt lägre än i andra undersökningar (23–33%) 10, 14, 15 . Orsakerna till skillnaderna mellan dessa studier och vår kan inkludera etnisk heterogenitet, inkludering av fall i sena steg och en större sannolikhet för kontaminering under provbehandling för paraffininbäddade vävnader än för färska vävnader. Det är viktigt att vår studie överensstämmer med tidigare undersökningar genom att de flesta PIK3CA- mutationer grupperade inom exon 9. Denna distribution är distinkt i livmoderhalscancer jämfört med andra typer av tumörer som uppvisar ofta PIK3CA- mutationer, såsom bröstcancer 19 och endometrial cancer 20 . Olika mutationshotspots i PIK3CA kan förutsäga olika svar på hämmare under terapi 13 .

PIK3CA-mutationer förekom oftare hos äldre och postmenopausala patienter i vår studie, vilket är i överensstämmelse med en studie utförd av Cui et al. 17 . Dessutom kan den histologiska subtypen fungera som en annan prediktor för PIK3CA- mutation vid livmoderhalscancer. Liknande våra resultat, Alexi et al. observerade också en högre mutationsgrad i SCC-prover än i AC-prover, även om skillnaden i deras studie inte nådde statistisk signifikans, vilket sannolikt beror på det begränsade antalet fall som ingår i deras analyser 14 . Inga signifikanta skillnader i mutationsfrekvenser observerades i tumörundergrupper enligt andra kliniska egenskaper.

Föreningen mellan PIK3CA- mutationsstatus och prognos var oöverträffande. I en studie utförd av McIntyre et al. , PIK3CA- mutation är förknippad med en sämre total överlevnad hos patienter med FIGO-stadium IB / II livmoderhalscancer som behandlats med radikal kemoradioterapi 15 . Däremot en studie utförd av Hou et al. föreslog att PIK3CA- mutation är förknippad med en betydligt längre total överlevnad hos patienter med metastaserande eller återkommande livmoderhalscancercarcinom 10 . Wright et al. rapporterade att PIK3CA-mutationer var förknippade med kortare överlevnad i ospecificerade livmoderhalscancer 14 . I vår studie av en stor kohort av kinesiska patienter som genomgick kirurgi-baserad multimodal terapi, var PIK3CA- mutationer associerade med en längre RFS på både univariat analys och multivariat analys inklusive nästan alla riskfaktorer för återfall (patologisk undergrupp, FIGO-stadium, lymfkörtelmetastas, parametrial engagemang, lymfkärls involvering och djup myometri invasion).

Det fanns några studier som behandlade att PIK3CA- mutation associerad med behandlingsresultat vid livmoderhalscancer 10, 14, 15, 21, emellertid var provstorlekarna för små för att dra en slutsats. I denna studie av en stor kohort av kinesiska patienter som genomgick kirurgisk baserad multimodal terapi, var PIK3CA- mutationer associerade med en längre RFS på både univariat analys och multivariat analys inklusive olika riskfaktorer för återfall. Tvärtom, rapporterades PIK3CA- mutation vara associerad med dåligt svar eller dålig överlevnad efter definitiv strålbehandling av McIntyre et al. 15 och De la Rochefordiere et al. 21 . Vidare hade det observerats att konstitutivt aktiverad PI3K-bana främjade resistens mot strålning och hämmare av PI3K-vägen radiosensibiliserade mänskliga livmoderhalscancercellinjer 22, 23 . Orsakerna till skillnaderna mellan vår studie och deras studier var som följer: (1) alla tumörer i denna studie var kirurgiskt resekterade cancerformer som arrangerades som FIGO IB1-IIA2, relativt tidigare stadium än tumörerna behandlade med primär definitiv strålterapi i de andra studierna ; (2) I denna studie fick alla patienter primära radikalkirurgier och en betydande del av patienterna fick adjuvansstrålning efter radikal kirurgi. Efter radikal kirurgi fanns det inga synliga kvarvarande tumörer i patientens kropp, vilket skulle minimera påverkan av PIK3CA- mutation på radioresistens; (3) Vi observerade högre risk för avlägsna metastaser efter behandling i PIK3CA vildtypskohort (14, 7%) än PIK3CA-mutantkohort (7, 6%) (p = 0, 048). Även om orsaken till detta inte är klar har liknande resultat rapporterats i bröstcancer. Sabine et al. rapporterade att patienter med bröstcancer utan PIK3CA- mutationer hade en signifikant högre risk för avlägsna metastaser än patienter vars tumörer innehöll PIK3CA- mutation 24 .

Denna studie innehåller vissa begränsningar. Först, med tanke på att HPV-genotypning inte rutinmässigt analyserades för hantering av livmoderhalscancer, inkluderades inte HPV-genotypningsanalys i denna studie. För det andra, om de sällsynta mutantvarianter som observerats i vår studie kan aktivera PI3K- vägen kräver funktionell verifiering. För det tredje beräknades den totala överlevnaden (OS) inte i denna studie på grund av den relativt korta uppföljningsperioden och den lilla andelen patienter som dör av livmoderhalscancer. På grund av det begränsade antalet fall med en mutation i exon 20 kunde vi inte heller jämföra kliniska egenskaper mellan patienter med PIK3CA- mutationer i exon 9 och patienter med PIK3CA-mutationer i exon 20.

Sammanfattningsvis visar våra uppgifter att en betydande del av kinesiska patienter i livmoderhalscancer har mutant PIK3CA . Patienter med mutanta PIK3CA- tumörer uppvisar signifikanta skillnader jämfört med patienter med PIK3CA vildtypstumörer med avseende på ålder, menopausal status, histologisk subtyp, behandlingsresultat och återkommande mönster efter kirurgisk baserad multimodal terapi.

metoder

Patienter och prover

Denna studie godkändes av etikkommittén vid Fudan University Shanghai Cancer Center (FUSCC 050432-4-1212B) och genomfördes i enlighet med de godkända riktlinjerna. Alla patienter gav skriftligt informerat samtycke. Totalt inkluderades 771 kinesiska kvinnor i denna studie. Var och en av dem uppfyllde följande kriterier: patologiskt bekräftat primärt livmoderhalscancer, FIGO-steg IB1-IIA2-sjukdom, ingen neoadjuvant kemoterapi eller strålbehandling, som genomgått radikal kirurgi för den primära tumören och ingen preoperativ konisering. Tumörproverna bereddes och bearbetades såsom tidigare beskrivits 8 . Cervikala tumörprover samlades in under radikala hysterektomi eller trakelektomiförfaranden mellan januari 2010 och december 2012. Histologisk bedömning av proverna utfördes av två oberoende patologer (Xuxia Shen och Wentao Yang), och endast prover med mer än 50% tumörceller inkluderades i vår analys. Tumörproverna bevarades i RNAlater-lösning (Ambion) och lagrades vid -80 ° C tills de analyserades. Klinikopatologiska data hämtades prospektivt från patientläkarundersökningar. Patienterna följdes upp regelbundet tills återfall återkom.

Mutationsanalys

PIK3CA- mutationsanalys utfördes utan förkunskaper om patientens klinikopatologiska och uppföljningsdata. Totalt RNA extraherat från tumörvävnaderna transkriberades omvänt till enkelsträngat cDNA med användning av ett M-MLV omvänt transkriptas-kit (Invitrogen). Den spiralformade domänen (HD) och kinasdomänen (KD) för PIK3CA amplifierades PCR med KOD-Plus-Neo DNA-polymeras (Toyobo) med användning av följande primrar: HD-F: TTCAGCAGTGTGGTAAAGTTCC; HD-R: TACCAAGCAATACATCTGGGCTAC; KD-F: CTGGATACTGTGTAGCTACCTT; KD-R: ATGGATTGTGCAATTCCTATG. PCR-produkterna sekvenserades direkt från båda ändarna med användning av Sanger-sekvensering. Alla mutationer bekräftades genom en ytterligare oberoende PCR.

Statistisk analys

Relevansen mellan PIK3CA- mutationer och klinikopatologiska egenskaper analyserades med Student's t-test, Pearsons chi-square test eller Fishers exakta test. Återfallsfri överlevnad (RFS) definierades som tiden från operation till den första lokala, lymfkörtel eller avlägsna återfall. Avlägsen metastas definierades som varje återfall utanför bäckenhålan. Patienter som dog utan bevis på sjukdom censurerades. På grund av den korta varaktigheten för patientuppföljning beräknades inte den totala överlevnaden (OS) i denna studie. RFS bedömdes med hjälp av Kaplan-Meier-metoden, och skillnader mellan grupperna analyserades med hjälp av log-rank-testet. Faroförhållanden (HR) beräknades med användning av Cox-proportionalfara-modeller. Den tvåsidiga signifikansnivån sattes till P <0, 05. Data analyserades med hjälp av IBM SPSS Statistics 19 (IBM).

ytterligare information

Hur man citerar den här artikeln : Xiang, L. et al. PIK3CA- mutationsanalys hos kinesiska patienter med kirurgiskt resekterad livmoderhalscancer. Sci. Rep 5, 14035; doi: 10.1038 / srep14035 (2015).

Förändra historien

Kompletterande information

PDF-filer

  1. 1.

    Kompletterande information

kommentarer

Genom att skicka en kommentar samtycker du till att följa våra villkor och gemenskapsriktlinjer. Om du finner något missbruk eller som inte överensstämmer med våra villkor eller riktlinjer ska du markera det som olämpligt.