March1 reglerar insulinkänslighet genom att kontrollera cellytans insulinreceptornivåer | naturkommunikation

March1 reglerar insulinkänslighet genom att kontrollera cellytans insulinreceptornivåer | naturkommunikation

Anonim

ämnen

  • Insulin signalering
  • Ämnesomsättning
  • Ubiquitylation

Abstrakt

Insulinresistens är en viktig drivkraft för typ 2-diabetes (T2D) och kännetecknas av defekt insulinreceptor (INSR) signalering. Även om ytreglering av INSR-underreglering är en väletablerad bidragare till insulinresistens, förblir de underliggande molekylära mekanismerna otydliga. Här visar vi att E3 ubiquitin ligas MARCH1 försämrar cellulär insulinverkan genom att försämra cellytan INSR. Med hjälp av en storskalig RNA-interferensskärm identifierar vi MARCH1 som en negativ regulator för INSR-signalering. Funktionsförlust av mars 1 förbättrar och överuttryck från mars 1 försämrar insulinkänsligheten hos möss hos lever. MARCH1 ubikvitinerar INSR för att sänka INSR-nivåerna på cellytan, men till skillnad från andra INSR-ubiquitin-ligaser verkar MARCH1 i basala tillstånd snarare än efter insulinstimulering. Således kan MARCH1 hjälpa till att fastställa basalförstärkning av insulinsignalering. MARCH1- uttrycket ökas i vit fettvävnad hos feta människor, vilket antyder att MARCH1 bidrar till patofysiologin för T2D och kan vara ett nytt terapeutiskt mål.

Introduktion

Insulin har kraftiga metaboliska och mitogena effekter som medieras genom bindning till insulinreceptorn (INSR) 1 . Dysregulerad insulinsignalering är central för patogenesen av det metaboliska syndromet och typ 2-diabetes (T2D), och är alltmer involverat i olika humana cancerformer 2 . Insulinresistenta vävnader kräver ökad insulinsekretion för att ge fysiologiska svar, och denna kompensatoriska hyperinsulinemi är skadlig både för den överutsträckta p-cellen och för dess mitogena effekter på cancerceller 2 . En förbättrad förståelse för både normal insulinsignalering och cellulär insulinresistens kommer att leda utvecklingen av nya terapier riktade mot denna axel.

Insatser för att förstå den molekylära basen för insulinresistens har inneburit flera intracellulära processer 3 . Den starka sambanden mellan ackumulering av ektopisk lipid i lever- och muskel- och insulinresistens i dessa vävnader har lett till hypotesen att bioaktiva lipidmetaboliter, såsom diacylglycerol, ceramider och acylkarnitiner, påverkar insulinsignaleringseffekterna 4, 5 . Nedsatt INSR-signalering är i synnerhet en väl etablerad defekt i typisk fetma-associerad insulinresistens 6 . INSR-dysregulering har två huvudkomponenter: minskad INSR-tyrosinkinasaktivitet och minskad yta INSR-innehåll 7, 8, 9 . Den förra processen har kopplats till ektopisk lipidansamling genom aktivering av PKCK, men cellulära mekanismer som förmedlar det senare förfarandet förstås ofullständigt 10, 11, 12 .

INSR-dysregulering har djupa effekter på hela kroppens metabolism. Patienter med INSR- mutationer (Donohue-syndrom, Rabson – Mendenhall-syndrom) uppvisar stora tillväxtdefekter och insulinresistens så svårt att efterlikna obehandlad typ 1-diabetes 13 . Gnagerstudier av global och vävnadsspecifik INSR-borttagning har bekräftat de allvarliga konsekvenserna av nedsatt INSR-funktion 14 . Tillsammans antyder dessa studier att cellulära regulatorer av INSR själv, snarare än signalströmeffektörer nedströms, kan ha särskilt djupa effekter på cellulär insulinsignalering. Därför kommer identifiering av sådana endogena INSR-regulatorer att hjälpa ansträngningarna att förstå cellregleringen av insulinsignalering och kan avslöja nya terapeutiska mål för behandlingen av T2D och andra patologier relaterade till avvikande insulinsignalering.

Flera E3 ubiquitin-ligaser är kända negativa regulatorer för insulinsignalering. Både INSR- och insulinreceptorsubstratproteiner (IRS) -proteiner regleras av ubiquitination 15, 16, 17, 18, 19 . Den kanoniska modellen för ubikitination av INSR involverar insulinberoende rekrytering av E3-ligaset, underlättar endocytos och endosomal sortering för att dämpa signalering från den aktiverade INSR 18 . CBL och NEDD4 är två ubikitinligaser implicerade i denna process 18, 20, 21 . Emellertid kan ubiquitinkodens komplexitet - monoubikitination, multimonoubikitination och polyubikitination tjäna olika funktioner och hundratals E3-ligaser kodas i genomet - antyder att den nuvarande förståelsen för ubikitinationens roll i insulinsignalering är ofullständig. I detta avseende antog vi att systematisk analys av ubiquitinligaser skulle ge insikt i cellulär reglering av insulinsignalering. Här, med syftet att identifiera repressorer för insulinsignalering, utförde vi en storskalig RNAi-skärm inriktad på 616 humana E3 ubiquitin-ligaser. Vår storskaliga RNAi-skärm identifierade MARCH1 som en potent och tidigare ostudierad repressor för insulinsignalering. Funktionella studier som använder flera cellbaserade och musmodeller avslöjade att MARCH1 i sig är insulinreglerad och att det är både nödvändigt och tillräckligt för normal cellkontroll av insulinverkan. Ytterligare arbete visade att MARCH1 verkar genom att reglera ytins INSR-nivåer i basal låginsulinstatus, och stämma cellulär insulinkänslighet. Notera att denna mekanism skiljer sig från den från tidigare rapporterade INSR ubiquitin-ligaser, som aktiveras endast efter insulinstimulering.

Resultat

RNAi-skärmen identifierar repressorer för insulinsignalering

För att identifiera nya repressorer för insulinsignalering genomförde vi en opartisk storskalig RNAi-skärm. För att utföra skärmen genererade vi ett lentiviralt shRNA-bibliotek som innehöll totalt 2 833 shRNA som var inriktade på 616 E3 ubiquitin-ligaser och deras adapterproteiner (kompletterande tabell 1). Valet att inrikta sig på E3 ubiquitin-ligaser styrdes av vårt erkännande att trots de olika och potenta cellfunktionerna för ubiquitinering, är reglering av insulinsignaleringseffektorer med ubiquitin-koden ofullständigt förstått men sannolikt kommer att delta starkt i den cellulära kontrollen av insulinverkan.

RNAi-skärmen utnyttjade kravet från HeLa-celler för höga koncentrationer av insulin när de odlades i serumfritt medium (kompletterande figur 1a). HeLa-celler uppvisade intakt insulinsignalering, vilket indikeras av robust insulinstimulering av AKT Ser 473- fosforylering (kompletterande fig. Ib).

För att påbörja storskalig RNAi-skärm (fig. 1a) infekterade vi HeLa-celler med tre olika pooler av E3-ubiquitin-ligasbibliotek i tre exemplar; varje pool innehöll ∼ 1 000 shRNA som var inriktade på 200 gener. Kontrollceller infekterades med ett icke-specifikt shRNA (NS shRNA). Efter infektion odlades cellerna i suboptimala insulinkoncentrationer (0, 05 μg ml −1 ; 8, 6 nM) otillräckliga för att stödja HeLa-celltillväxt och överlevnad. Fortsatt kultur i suboptimala insulinkoncentrationer tillhandahöll således selektionstryck som gynnade kloner vars shRNA gav en insulinsensibiliserande effekt. Efter 4 veckor i suboptimal insulin samlades överlevande kolonier och genomiskt DNA isolerades och sekvenserades för att identifiera kandidatgener. Vi återhämtade sju kandidat-repressorer av insulinsignalering, för vilka flera shRNA identifierades genom sekvensering i alla tre replikaten (kompletterande tabell 2).

( a ) Schematisk sammanfattning av RNAi-skärmen. ( b ) Relativt cellnummer ( n = 3), beräknat med användning av Trypan-blå uteslutning, för HeLa-celler som uttrycker indikerade shRNA och odlas i suboptimal insulinkoncentration (0, 05 μg ml −1 ) under det angivna antalet dagar. * jämför NS och MARCH1 shRNA på dag 10. ( c ) Immunoblotanalys av AKT Ser 473- fosforylering i HeLa-celler som uttrycker antingen NS eller MARCH1 , MARCH9 eller NHLRC1 shRNA. ( d ) Relativt 14 C-2-deoxyglukosupptag ( n = 4) i HeLa-celler som uttrycker indikerade shRNA. * jämför NS och indikerade shRNA i närvaro av insulin. ( e ) Relativ glykogensyntes ( n = 3) i HeLa-celler som uttrycker indikerade shRNA. * jämför NS och indikerade shRNA i närvaro av insulin. I alla paneler är data genomsnitt ± sem och * P <0, 05, jämförelser med t- test. NS, nonsilencing.

Bild i full storlek

Validering av kandidatrepressorer för insulinsignalering

Efter att ha identifierat de sju potentiella repressorerna för insulinsignalering utförde vi flera analyser för att undersöka deras roll i insulinverkan. Först slog vi individuellt ner alla sju kandidater med hjälp av två sekvensoberoende shRNA: er (kompletterande fig. 1c). Knockdown av någon av de sju kandidaterna möjliggjorde robust spridning i 0, 05 μg ml −1 insulin, medan kontroll-SHRNA-uttryckande celler misslyckades med att spridas (fig. 1b och kompletterande fig. 2a). Detta var inte sekundärt till en insulinoberoende mitogen fördel, eftersom inga skillnader i proliferation observerades i 10% serum-kompletterat medium (Fig. Ib och kompletterande Fig. 2b).

Efter detta testade vi direkt effekten av varje kandidatrepressor på insulinsignalering genom att stimulera serum-svältade HeLa-celler med 0, 05 μg ml −1 insulin. Av de sju kandidaterna resulterade shRNA-inducerad knockdown av tre ( MARCH1 , MARCH9 och NHLRC1 ) i ökad AKT Ser 473- fosforylering (fig. 1c och kompletterande fig. 2c), ökat 14 C-2-deoxyglukos (2-DG) upptag (Fig. 1d och kompletterande fig. 2d) och ökad glykogensyntes (fig. 1e och kompletterande fig. 2e).

Därefter undersökte vi om några identifierade kandidater var fysiologiskt relevanta repressorer av insulinsignalering. Med tanke på att ökat uttryck av kandidatgenen i insulinresistent vävnad skulle kunna indikera att genen bidrar till insulinresistens, undersökte vi om mRNA-uttryck av någon kandidatgen uppreglerades i mat med hög fetthalt (HFD), insulinresistenta möss. Endast mars 1- uttrycket reglerades signifikant av HFD i vit fettvävnad (WAT) (fig. 2a). På grundval av dessa resultat mätte vi MARCH1- uttryck i WAT-biopsier från feta och magera ungdomar. I överensstämmelse med våra resultat i HFD-matade möss ökades MARCH1- uttrycket ungefär två gånger i WAT från feta människor (fig. 2b). Vidare avslöjade mikroarray-genuttrycksanalys av samma patientkohort stratifierad till insulinkänsliga och insulinresistenta grupper ökad MARCH1- expression i den insulinresistenta gruppen (1, 29 gånger, P = 0, 006) (ref. 22). Vi fokuserade därför efterföljande studier på MARCH1, som primärt har studerats i sekundära lymfoida vävnader 23, 24, 25, 26 och inte tidigare har kopplats till insulinsignalering eller metabolisk reglering.

( a ) qRT-PCR-mätning av mars1- uttryck i WAT hos vuxna manliga C57BL / 6 J-möss som matades antingen med regelbunden chow eller fettrik diet. ( b ) qRT-PCR-mätning av MARCH1- uttryck i WAT från mager ( n = 8) och feta ( n = 13) mänskliga ungdomar. ( c ) Immunoblot-analys av AKT Ser 473- fosforylering i differentierade 3T3-L1-adipocyter som uttrycker indikerade shRNA. ( d ) Relativt 14 C-2-deoxyglukosupptag ( n = 4) i differentierade 3T3-L1 adipocyter som uttrycker antingen NS eller March1 shRNA. ( e ) Relativ glykogensyntes ( n = 3) i differentierade 3T3-L1 adipocyter som uttrycker antingen NS eller March1 shRNA. ( f ) Immunoblotanalys av AKT Ser 473- fosforylering i HepG2-hepatocyter som uttrycker antingen NS eller MARCH1- shRNA. ( g ) Relativ glykogensyntes ( n = 3) i HepG2-hepatocyter som uttrycker antingen NS eller MARCH1 shRNA. I d, e, g, * jämför NS och MARCH1 shRNA i närvaro av insulin. I alla paneler är data genomsnitt ± sem och * P <0, 05, jämförelser med t- test. qRT-PCR, kvantitativ realtids-PCR.

Bild i full storlek

För att testa om MARCH1- knockdown kunde öka insulinverkan i fysiologiskt relevanta celltyper använde vi 3T3-L1 adipocyter och HepG2-hepatocyter (kompletterande fig. 2f – g). Vi fann att insulinstimulerad AKT-fosforylering (fig. 2c), 2-DG-upptag (fig. 2d) och glykogensyntes (fig. 2e) ökades signifikant genom knockdown av mars 1 i 3T3-L1-adipocyter. På liknande sätt visade HepG2-hepatocyter förbättrad insulin-stimulerad AKT-fosforylering (fig. 2f) och glykogensyntes (fig. 2g) efter MARCH1- knockdown.

Knockdown från mars 1 förbättrar insulinkänsligheten hos möss

För att undersöka in vivo- rollen av MARCH1 i insulinverkan, genomförde vi först en förlust-av-funktion-metod, behandlade möss med 2'- O- metoxietyl-chimär antisense-oligonukleotider (ASO) riktade till March1- mRNA eller med en kontroll-ASO riktad mot ingen känd mus gen. 1 mars ASO uppnådde transkript knockdown på ∼ 60% i levern och ∼ 80% i WAT efter 2 veckors behandling, utan knockdown i skelettmuskler eller bevis på hepatotoxicitet (Fig. 3a och kompletterande Fig. 3a – d). När de blev utmanade med HFD under de två veckorna av ASO-behandling skilde möss som fick March1 ASO inte signifikant i kroppsvikt utan fick mindre fettmassa än kontroller (kompletterande figur 3e – f).

Manliga 12–20 veckor gamla C57BL / 6 J-möss behandlades med ASO under 2 veckor och matades regelbundet med chow eller HFD som anges. ( a ) Relativt mars1- mRNA-uttryck i lever och WAT. ( b, c ) Plasmaglukos ( b ) och insulin ( c ) utflykter under ipGTT. ( d ) Plasmaglukos- och glukosinfusionshastigheter under hyperinsulinemisk-euglykemisk klämstudier på möss som matades regelbundet med chow eller 3 veckor HFD och behandlades med March1 ASO eller kontroll ASO. # anger jämförelse mellan chow-matade grupper och * betecknar jämförelse av HFD-matade grupper. ( e ) EGP under basperioden och under klämmans jämviktstid. ( f ) Undertryckning av EGP under klämman, uttryckt som% basal EGP. ( g ) Undertryckning av plasma-NEFA-koncentrationer under klämman, uttryckt som% basal. ( h ) Hela kroppens glukosupptag under klämman. Data är medelvärde ± sem I alla paneler, * P <0, 05, ** P <0, 005, ## P <0, 005, *** P <0, 0005, ### P <0, 0005. I a, n = 3 möss per grupp; jämförelser med två-tailed oparad t- test. I b, c, n = 5–8 möss per grupp; jämförelser med tvåvägs ANOVA. I d - h är n = 9–11 möss per grupp; jämförelser med tvåvägs ANOVA. ANOVA, variansanalys; ipGTT, intraperitoneal glukostoleranstest.

Bild i full storlek

Under intraperitoneal glukosetoleranstest av både chow-matade och HFD-matade möss förbättrade March1 ASO glukostoleransen utan att påverka insulinnivåerna - vilket tyder på förbättrad insulinkänslighet snarare än förbättrad insulinsekretion (Fig. 3b, c och kompletterande Fig. 3g, h). Hos chow-matade möss förbättrades den insulinsensibiliserande effekten av March1 ASO ytterligare genom att utvidga ASO-behandlingen till fyra veckor; utöver förbättrade plasmaglukosutflykter visade ASO-behandlade möss under 4 veckor från mars 1 signifikant minskade insulinutflykter (kompletterande figur 3i, j). För att testa huruvida den uppenbara insulinsensibiliserande effekten av March1 ASO-behandling kunde tillskrivas ökade energiförbrukningar eller minskade kaloriintag utförde vi metaboliska burstudier. Dessa experiment avslöjade ingen effekt av March1 ASO på energiförbrukning, lokomotorisk aktivitet, kaloriintag, O2-konsumtion eller andningskvotient på varken vanlig chow eller HFD (Kompletterande Fig. 3k – q).

Slutligen utförde vi hyperinsulinemisk-euglykemisk klämstudier i vakna möss för att undersöka vävnadsspecifika effekter av knockdown från mars 1 på insulinkänslighet. För att öka vår kraft att upptäcka en insulinsensibiliserande effekt av knockdown från mars 1 på vanlig chow-diet, använde vi en låg insulindos på 2, 0 mU kg −1 min −1, förväntat submaximalt undertrycka endogen glukosproduktion (EGP) i kontroll av ASO-behandlad, chow-matade möss. Plasmainsulinnivåer höjdes till liknande nivåer under klampstudierna (kompletterande figur 3r). I både chow-matade och HFD-matade möss ökade knockdown från mars 1 glukosinfusionshastigheten som krävs för att upprätthålla euglycemia jämfört med kontroller, vilket visade förbättrad insulinkänslighet för hela kroppen (fig. 3d och kompletterande fig. 3s). Insulinundertryckning av EGP förstärktes av March1 ASO ungefär tvåfaldigt på chow-diet och ungefär sexfaldigt på HFD, vilket indikerade förbättrad insulininsats i levern (Fig. 3e, f). Dessutom ökades insulinundertryckningen av plasma-icke-förestrade fettsyranivåer (NEFA) med March1 ASO, vilket återspeglade förbättrad insulinverkan i WAT (Fig. 3g). Insulinstimulerat perifert glukosupptag förändrades emellertid inte signifikant, i överensstämmelse med tropismen i ASO (Fig. 3h). Tillsammans erbjuder dessa ASO-studier in vivo bevis för negativ reglering av lever- och fettinsulinsignalering av MARCH1 i både insulinkänsliga och insulinresistenta möss.

Mars 1 - / - möss är insulinkänsliga på både chow och HFD

För att ytterligare undersöka effekten av MARCH1-förlusten på insulinverkan hos möss utförde vi hyperinsulinemisk-euglykemisk klämstudier i en tidigare fastställd linje från mars1 - / - möss 27 . Vid regelbunden chow-diet minskade ålders- och viktmatchade manliga mars1 - / - möss av fastande plasmainsulin men liknande fastande glukos (Fig. 4a och Kompletterande Fig. 4a, b). Under studier med hyperinsulinemisk-euglykemisk klämma krävde chow-matade mars1 - / - möss signifikant högre glukosinfusionshastigheter för att upprätthålla euglykemi jämfört med vildtypskullkamratkontroller (Fig. 4a, b). Denna ökning av insulinkänslighet för hela kroppen berodde på förbättrat EGP-undertryck; insulinstimulerat perifert glukosupptag skilde sig inte signifikant mellan grupperna (fig. 4c och kompletterande fig. 4c, d). Vi utförde även intraperitoneal glukosetoleranstest i kvinnliga chow-matade mars1 - / - möss, vilket avslöjade förbättrad glukostolerans utan skillnad i plasmainsulin - vilket tyder på förbättrad insulinkänslighet (Kompletterande Fig. 4e – g). För att testa huruvida radering av mars 1 skulle ge skydd mot HFD-inducerad insulinresistens, utsatte vi mars1 - / - möss för 3 veckors matning med fetthalt. Mars 1 - / - möss visade statistiskt obetydliga trender mot lägre kroppsvikt, fett och fastande plasmainsulin (kompletterande bild 4h – j). Under studier med hyperinsulinemisk-euglykemisk klämma krävde HFD-matade mars1 - / - möss igen högre glukosinfusionshastigheter för att upprätthålla euglykemi, en effekt som stod för både förbättrat EGP-undertryckande och av en statistiskt obetydlig trend mot ökat perifert glukosupptag (Fig. 4d– f och kompletterande figur 4k, l). Tillsammans överensstämmer dessa data med fenotypen från mars 1 ASO-behandlade möss och indikerar att MARCH1-förlusten förbättrar insulininsatsen hos lever i möss.

Littermate vildtypskontrollmöss användes i alla studier av mars1 - / - möss. Olika insulininfusionshastigheter användes för studier av chow-matade och HFD-matade möss (2 respektive 3 mU kg −1 min −1 ), så att data inte överlagras. ( a ) Plasmaglukos- och glukosinfusionshastigheter under hyperinsulinemisk-euglykemisk klampstudier på hanmöss som matades regelbundet med chow. ( b ) Genomsnittlig infusionshastighet för glukos vid steady-state hos chow-matade hanmöss. ( c ) Insulinundertryckning av EGP i chow-matade hanmöss, uttryckt som% basal EGP. ( d ) Plasmaglukos- och glukosinfusionshastigheter under hyperinsulinemisk-euglykemisk klämstudier på hanmöss som matades med HFD under 3 veckor. ( e ) Genomsnittlig infusionshastighet för glukos vid steady-state hos HFD-matade hanmöss. ( f ) Insulinundertryckning av EGP i HFD-matade hanmöss. Data är medelvärde ± sem I alla paneler * P <0, 05, ** P <0, 005. Alla jämförelser med två-tailed oparad t- test. I a - c är n = 10 WT och fem knockout-möss per grupp. I d - f är n = 5 möss per grupp.

Bild i full storlek

Överuttryck från mars 1 försämrar insulinverkan i muslever

För att undersöka huruvida MARCH1 är tillräcklig för att försämra insulinverkan in vivo , använde vi en adenoassocierad viral vektor (AAV) för att ektopiskt uttrycka March1- eller GFP-kontroll i levern. Möss studerades 4 veckor efter en enda intravenös AAV-dos. Trots en> 65-faldig ökning av mRNA-expressionen från March1, var mars1-proteinet knappt detekterbart i leverlysat genom immunblotting (fig. 5a, b) - i överensstämmelse med dess kända post-translationella autoregulering genom autoubiquitination 23, 26, 27, 28 . I överensstämmelse med vår hypotes krävde chow-matade möss som fick mars 1 AAV lägre glukosinfusionshastigheter under hyperinsulinemisk-euglykemisk klämstudier (fig. 5c, d och kompletterande fig. 5a). Denna minskning berodde på nedsatt EGP-undertryckning snarare än minskat perifert glukosupptag (fig. 5e, f och kompletterande fig. 5b), vilket indikerar att ektopiskt MARCH1-uttryck är tillräckligt för att försämra insulinverkan i muslever. Kroppsvikt var likartad mellan grupper under hela AAV-behandlingens längd (kompletterande fig. 5c).

Manliga 12-veckor gamla C57BL / 6 J-möss injicerades intravenöst med AAV 4 veckor före studier och matades regelbundet med chow. ( a ) Immunoblot-analys av GFP- och mars1-proteinuttryck efter AAV-behandling. ( b ) qRT-PCR-analys av lever-mRNA March1- expression efter AAV-behandling. ( c ) Plasmaglukos- och glukosinfusionshastigheter under hyperinsulinemisk-euglykemisk klämstudier. ( d ) Genomsnittlig infusionshastighet vid glukos vid steady-state som krävs för att upprätthålla euglycemia under klämman. ( e ) EGP under basperioden och under klämmans jämviktstid. ( f ) EGP-undertryckning. Data är medelvärde ± sem I alla paneler * P <0, 05, *** P <0, 0005. n = 7-8 möss per grupp; jämförelser med två-tailed oparad t- test. qRT-PCR, kvantitativ realtids-PCR.

Bild i full storlek

MARCH1- transkription förtrycks av insulin genom FOXO1

Därefter återvände vi till vår ursprungliga observation att MARCH1- uttrycket ökade hos feta mus och mänskliga WAT. På grund av att MARCH1- uppreglering i insulinresistens skulle överensstämma med förlust av normalt repression med insulin, testade vi om insulin reglerar MARCH1- uttrycket. I muslever, fann vi att MARCH1- uttrycket minskade genom akut insulinstimulering (Fig. 6a). Denna nedreglering bekräftades i odlade HeLa-celler, HepG2-hepatocyter och 3T3-L1-adipocyter (fig. 6b). Analys av MARCH1- promotorn och den intergena regionen avslöjade flera förmodade FOXO1-bindande ställen, och shRNA-medierad knockdown av FOXO1 i HeLa-celler minskade basal expression av MARCH1 (Fig. 6c, d). På liknande sätt avskaffade ektopiskt uttryck av FOXO1 med dess samaktivator PGC-la-inducerade MARCH1- uttryck i HeLa- och HepG2-celler, och uttryck av en konstitutivt aktiv FOXO1-mutant insulinreglering av MARCH1- uttryck (fig 6e). En MARCH1- promotor-luciferasreporter aktiverades av FOXO1 / PGC-la-samuttryck, och denna effekt krävde intakta FOXO1-bindningsställen i MARCH1- promotorn (fig. 6f). Kromatinimmunutfällningsförsök (ChIP) -experiment bekräftade att FOXO1 binder till MARCH1- promotorn i frånvaro av insulin och denna bindning inhiberades vid insulinaddition (Fig. 6g). Sammantaget visar dessa resultat att insulin förtrycker MARCH1- uttryck på ett FOXO1-beroende sätt.

( a ) qRT-PCR-mätning av mars1- uttryck i vildtypsmus WAT efter 6 timmars fasta (basal) eller efter 2 timmars insulinstimulering (klämma). n = 8 (basal) och 9 (klämma) möss per grupp. ( b ) qRT-PCR-mätningar av MARCH1- uttryck ( n = 3) i de angivna cellinjerna efter akut insulinstimulering vid de angivna doserna. ( c ) qRT-PCR-mätning av FOXO1- mRNA-uttryck ( n = 3) i HeLa-celler som uttrycker antingen ett NS- eller FOXO1- shRNA. ( d ) qRT-PCR-mätning av MARCH1 mRNA-uttryck ( n = 3) i HeLa-celler som uttrycker antingen ett NS- eller FOXO1- shRNA. ( e ) qRT-PCR-mätningar av MARCH1- uttryck ( n = 3) i HeLa (vänster) eller HepG2 (höger) celler som uttrycker tom vektor, FOXO1 av vildtyp, konstitutivt aktiv FOXO1 och / eller PGC-1a och behandlas med insulin som indikerat . ( f ) Luciferasreporteranalys ( n = 3) för vildtyp MARCH1- promotor (vänster) eller en mutant MARCH1- promotor med ett muterat FOXO1-bindningsställe (höger) i HeLa-celler som uttrycker tom vektor, vildtyp FOXO1 , konstitutivt aktiv FOXO1 ( FOXO1 CA ), och / eller PGC-la och behandlades med insulin som angivet. ( g ) ChIP-mätning av FOXO1-proteinanrikning på MARCH1- eller ACTIN- promotorn med och utan insulinbehandling ( n = 3) såsom anges. Data är medelvärde ± sem I alla paneler, * P <0, 05, jämförelser med t- test. qRT-PCR, kvantitativ realtids-PCR.

Bild i full storlek

MARCH1 kontrollerar plasmamembraninsulinreceptornivåer

Efter att ha bekräftat en fysiologisk och patofysiologisk roll för MARCH1 i insulinsignalering syftade vi nästa till att bestämma mekanismen genom vilken MARCH1 försämrar insulinverkan. MARCH1- knockdown i HeLa- och 3T3-L1-celler stimulerade med suboptimal insulin var associerat med förbättrad AKT-, IRS1- och INSR-fosforylering, vilket indikerar att den insulinsensibiliserande effekten av MARCH1- knockdown kunde spåras till förbättrad INSR-aktivering (fig. 7a och kompletterande fig. 6a ). På liknande sätt var ektopiskt uttryck av vildtyp MARCH1 tillräckligt för att hämma INSR-tyrosinfosforylering, med följdeffekter på IRS1 och AKT-fosforylering (fig. 7b). RING-CH E3-ligasdomänen för MARCH1 var nödvändig för denna funktion; MARCH1 ΔRING misslyckades med att undertrycka INSR, IRS1 och AKT-fosforylering (Fig. 7b). Dessa resultat visar att MARCH1-kontroll av insulinsignalering sker genom modulering av insulinreceptoraktivering.

( a ) Immunoblot-analys av insulinstimulerad INSR, IRS-1 och AKT-aktivering i HeLa-celler som uttrycker de indikerade shRNA: erna. ( b ) Immunoblot-analys av insulin-stimulerad INSR-, IRS1- och AKT-aktivering i HeLa-celler som uttrycker de indikerade konstruktionerna. ( c ) Insulindos-svarskurvor i HeLa-celler som uttrycker NS eller MARCH1 shRNA # 1, konstruerade med användning av AKT pSer 473 immunoblot densitometri (se även kompletterande figur 6d). ( d ) Biotinyleringsanalys för cellytuttryck av INSRa och INSRP i serum-svaltade HeLa-celler som uttrycker NS eller MARCH1 shRNA # 1, normaliserade till Na-K ATPas-intensitet (se även kompletterande figur 7a). ( e ) Flödescytometrisk mätning av ytan INSRa i HeLa-celler som uttrycker det indikerade shRNA. ( f ) Immunoblotanalys för cellytuttryck av INSRa och INSRP i GPMV: er isolerade från serum-svaltade HeLa-celler som uttrycker indikerade shRNA. Data är medelvärde ± sem In ( d ), n = 3 biologiska replikat. I alla paneler, * P <0, 05, jämförelser med oparad t- test.

Bild i full storlek

Eftersom effekten av MARCH1 på insulinsignaleringen var spårbar till differentiell INSR-tyrosinfosforylering, ansåg vi mekanismer som skulle stå för skillnader i detta steg. I experiment med insulintidskurs i HeLa och 3T3-L1-celler ökade MARCH1- knockdown AKT Ser 473- fosforylering vid tidiga tidpunkter men var förvånansvärt associerat med snabbare signalförfall, vilket antyder att till skillnad från andra ubiquitin-ligaser implicerade i insulinverkan verkar MARCH1 inte genom att främja ligandinducerad internalisering och nedbrytning av INSR (kompletterande figur 6b, c). I insulindos-svar-experiment visade emellertid HeLa-celler som uttrycker MARCH1 shRNA en vänsterförskjuten dos-responsfunktion utan ökning i maximal responsivitet - vilket tyder på ökad yta INSR 9 (fig. 7c och kompletterande fig. 6d – f). Eftersom det totala INSR-innehållet i celler inte förändrades genom MARCH1- knockdown (fig. 7a och kompletterande fig. 6a), frågade vi om MARCH1 specifikt förändrade ytuttryck av INSR. Vi mätte ytins INSR-poolen i HeLa-celler som uttrycker MARCH1 shRNA med hjälp av tre oberoende tekniker: biotinyleringsanalyser, flödescytometri och gigantiska plasmamembranvesikelförberedelser (GPMV). Alla tre tillvägagångssätt avslöjade ökade ytor INSR-nivåer i celler som uttrycker MARCH1 shRNA (fig. 7d – f och kompletterande fig. 7a, b). Andra potentiella mekanismer för MARCH1-kontroll av INSR-tyrosinfosforylering, inklusive reglering av PTP1B, förändringar i dynamin-medierad INSR-endocytos och förändrad INSR-avdelning i lipidflak / grottor, visade sig inte vara involverade i fenotypen (kompletterande fig. 7c – f) .

MARCH1 reglerar INSR-stabiliteten genom direkt ubiquitinering

Därefter undersökte vi om MARCH1-kontrollen av ytan INSR-poolen förmedlades genom direkt ubiquitination. Samimmunutfällningsförsök i HeLa- och HepG2-celler som uttrycker epitop-märkta konstruktioner avslöjade att MARCH1 och INSRp interagerar (fig. 8a). Vi kunde också upptäcka denna interaktion i endogena proteiner från både HeLa och HepG2-celler, men endast när MARCH1-nivåerna stabiliserades med användning av proteasominhibitorn MG132 (fig. 8b). Utan proteasominhibering håller MARCH1 autoubikitination sina proteinnivåer under gränsen för detektion av immunblotting 23, 26, 27, 28 . Vi genererade också flera MARCH1- borttagningsmutanter för att kartlägga MARCH1-domänerna som krävs för interaktion med INSRβ. Dessa experiment avslöjade att både transmembrandomäner såväl som en N-terminal cytoplasmatisk domän, men inte RING E3-ligasdomänen eller den C-terminala domänen, erfordras för MARCH1-INSRp-interaktionen (kompletterande figur 8a, b). Dessutom inhiberade deletering av någon av de transmembrane domänerna lokaliseringen av MARCH1 till plasmamembranet, jämfört med vildtypen MARCH1 (kompletterande figur 8c). Immunutfällt MARCH1 av vildtyp, men inte E3-ligasaktivitetsdefekt MARCH1, polyubikitinerade vidare INSRp-kinasdomänet in vitro (fig. 8c). För att undersöka om MARCH1 ubikvitinerar INSRβ i intakta celler, mätte vi INSRβ ubiquitinering medan vi modulerade MARCH1-nivåer. Vi fann att MARCH1- nedslagning minskade INSRp-ubikvitinering (fig. 8d och kompletterande fig. 9a), och att ektopiskt uttryck av vildtyp, men inte E3-ligasdefekt, MARCH1 var associerat med ökad INSRp-polyubikvitination i celler (fig. 8e och kompletterande fig. 9b). För att bekräfta att dessa effekter medieras direkt av MARCH1 utförde vi räddningsförsök som mätte INSRp-ubikvitering i MARCH1- shRNA-behandlade celler i närvaro eller frånvaro av ett shRNA-resistent MARCH1- cDNA. MARCH1 shRNA reducerade INSRp ubiquitination i förhållande till kontroller, men ektopiskt uttryck av denna konstruktion räddade denna minskning av ubiquitination (fig. 8f och kompletterande fig. 9c). För att utesluta potentiella förvirrande effekter av ektopiskt HA-ubiquitin-uttryck, mätte vi också endogen polyubikitination av INSRP och överensstämde med våra andra resultat, observerade att MARCH1- nedslagning reducerade INSRp-polyubikitination (fig. 8g). I överensstämmelse med dessa resultat ökade dessutom MARCH1 shRNA insulin-stimulerad INSR- och AKT-fosforylering, men denna effekt vändes efter uttryck av shRNA-resistent MARCH1 cDNA (fig 8h).

( a ) Samimmunutfällning av INSRP och MARCH1 från HeLa och HepG2-celler som uttrycker MARCH1 - YFP . ( b ) Samimmunutfällning av INSRp och endogen MARCH1 från HeLa och HepG2-celler behandlade med proteasominhibitorn MG132. ( c ) In vitro- ubikvitationsanalys. Ingången analyserades för MARCH1-uttryck. ( d ) Immunoblot-analys av INSRp-ubiquitination. HA-ubiquitinerade proteiner immunutfällda från HeLa-celler som uttryckte NS- eller MARCH1- shRNA och HA-ubiquitin immunblottades för INSRp och för HA-ubikitin. Lysater undersöktes för de angivna proteinerna. ( e ) Immunoblot-analys av INSRp-polyubikitination. HA-ubiquitinerade proteiner immunutfällda från HeLa-celler som uttrycker MARCH1-YFP eller MARCH1-ΔRING-YFP och HA-ubiquitin immunblottades för INSRp och för HA-ubiquitin. Lysater undersöktes för angivna proteiner. ( f ) Immunoblot-analys av INSRp-polyubikitination. HA-ubiquitinerade proteiner immunutfällda från HeLa-celler som uttrycker NS eller MARCH1 shRNA # 1 eller # 2 med eller utan shRNA-resistent MARCH1 cDNA immunblottades för INSRp och HA-ubiquitin. Lysater undersöktes för angivna proteiner. ( g ) Immunoblot-analys av INSRp-ubiquitination. Ubiqitinerade proteiner immunutfällda från HeLa-celler som uttrycker NS- eller MARCH1- shRNA: er immunblottades för INSRp och för Ubiquitin. Lysater undersöktes för de angivna proteinerna. ( h ) Immunoblot-analys av insulinstimulerad INSR- och AKT-aktivering i HeLa-celler. HeLa-celler som uttrycker NS- eller MARCH1- shRNA med eller utan shRNA-resistent MARCH1- cDNA analyserades för indikerade proteiner.

Bild i full storlek

Vi förutsågde att ubiquitinering av INSRP med MARCH1 skulle öka INSRP-omsättningen. I överensstämmelse med denna hypotes, var MARCH1 knockdown associerad med ökad ytinshalveringstid i serum-svaltade celler (fig. 9a, b och kompletterande fig. 10a, b). I närvaro av insulin förlorades denna effekt på halveringstiden - sannolikt avspeglande verkan av insulinstimulerade INSR-ubikvitationsvägar (kompletterande bild 10c – f). För att ytterligare undersöka denna potentiella kontrast med etablerade INSR-ubiquitineringsvägar, såsom återkopplingshämningen av CBL och NEDD4, använde vi GPMV-beredningar för att mäta ytan INSRp-uttryck i celler som uttrycker shRNA för antingen MARCH1 , CBL eller NEDD4 . Celler med knockdown av CBL eller NEDD4 visade ökad yts INSR efter insulinstimulering, men celler med knockdown av MARCH1 visade endast ökad yta INSR i basala tillstånd (kompletterande fig. 10 g, h). Dessa data stöder hypotesen att MARCH1 reglerar ytins INSR-nivåer specifikt i basalt, lågt-insulin-tillstånd - vilket skapar ett nytt paradigm för E3-ligas – INSR-interaktioner.

( a ) Yt INSRP-innehåll i GPMV: er från HeLa-celler som uttrycker de indikerade shRNA: erna och behandlats med cykloheximid (se även kompletterande fig. 7a). ( b ) Analys av ytins INSRp-halveringstid, normaliserad till Na-K ATPas-intensitet ( n = 3). ( c ) Samimmunutfällning av INSRP K1079R-GFP och MARCH1-MYC från HeLa-celler som uttrycker båda proteinerna. ( d ) Immunoblot-analys av INSRp-fosforylering i HeLa-celler som uttrycker vektorn, INSR-GFP WT eller INSR K1079R-GFP med eller utan insulinstimulering. ( e ) Immunoblot-analys av INSRP och Na-K ATPas-ytstabilitet i GPMV: er av HeLa-celler som uttrycker vildtyp eller K1079R INSR och behandlas med cykloheximid. Kort (övre) och lång (mitten) exponering av INSRp-blotting visas. ( f ) Densitometrisk kvantifiering ( n = 3) av band märkta som INSRP-GFP i e . ( g ) HeLa-celler transfekterades med vildtyp- eller K1079R-mutant INSR-GFP och antingen vildtyps- eller -RING MARCH1-YFP-konstruktioner. GPMV: er analyserades med avseende på INSRP och Na-K ATPas och lysat analyserades med avseende på MARCH1-YFP genom immmunoblot-analys. Data är medelvärde ± sem In ( e ), n = 3 biologiska replikat. I alla paneler * P <0, 05, jämförelser med t- test.

Bild i full storlek

För att bestämma ubiquitineringsstället för MARCH1 på INSRP utförde vi LC-MS / MS-analys av immunutfällt INSRp. Dessa experiment identifierade INSR Lys 1079 som företrädesvis ubikvitinerade i celler som överuttryckte MARCH1 jämfört med tom vektorkontroll (kompletterande figur 11). För att testa rollen som MARCH1-medierad ubiquitination av INSRp vid Lys 1079, muterade vi Lys 1079 till arginin (K1079R). INSRP K1079R-mutation påverkade inte INSRP-MARCH1-interaktionen eller insulinstimulerad INSR-autofosforylering (Fig. 9c, d). INSRβ K1079R visade emellertid ökad cellytstabilitet (Fig. 9e – g). Sammantaget identifierar dessa resultat INSRP Lys 1079 som ett potentiellt MARCH1-substrat med förmåga att reglera ytan INSRp-uttryck.

Diskussion

Våra resultat, sammanfattade i fig. 10, identifierar E3 ubiquitin ligas MARCH1 som en ny repressor för insulinreceptorsignalering. Vi fann att MARCH1 hämmar potentiellt cellulär insulinkänslighet i flera celltyper inklusive hepatocyter och vita adipocyter, och i sig är transkriptionsreglerat av insulin genom transkriptionsfaktorn FOXO1. In vivo- nedslagning av mars 1- uttryck i lever och WAT ökade insulinkänsligheten hos vanliga chow-matade möss och förhindrade insulinresistens hos möss med hög fetthalt. Omvänt var AAV-inducerat ektopiskt uttryck av mars 1 i musleveren tillräckligt för att inducera insulinresistens hos vanliga möss med matning med chow. Effekten av MARCH1 på cellulär insulinkänslighet medierades genom direkt ubiquitinering av INSRp av MARCH1. Genom att förändra halveringstiden för ytan INSRP kontrollerar MARCH1 ytan INSR-poolen och reglerar således insulinkänsligheten.

I basaltillståndet ubikitinerar och bryter MARCH1 ned INSRP; varigenom ytan INSR-uttryck reduceras. I det insulinkänsliga tillståndet inhiberar INSR-aktivering FOXO1, vilket resulterar i transkriptionell förtryck av MARCH1 , ökade ytor av INSR och bevarad insulinsignalering. I det insulinresistenta tillståndet misslyckas insulin med att hämma FOXO1, vilket resulterar i otillbörligt ökat MARCH1-uttryck, minskade ytor av INSR-nivåer och försämrad insignalsignalering.

Bild i full storlek

Ubiquitination spelar en central roll i många biologiska processer 29 . Ubiquitin-vägen involverar den sekventiella överföringen av ubiquitin från ett ubiquitin-aktiverande enzym (El) till ett ubiquitinkonjugas (E2) och sedan till ett substratprotein via verkan av ett E3-ubiquitin-ligas. Det mänskliga genomet kodar för flera hundra E3-ligaser och deras adapterproteiner, som ger specificitet till ubiquitinvägen 30 . MARCH-familjen av E3 ubiquitin-ligaser innehåller elva gener, varav de flesta innehåller minst två transmembranregioner 31, 32 . MARCH-familjeproteiner är kända för att nedreglera en undergrupp av membranproteiner, men att bestämma specifika fysiologiska roller för MARCH-isoformer har visat sig vara svårt, delvis på grund av begränsad förståelse för deras uttryck, reglering och substrat 32, 33 . MARCH1 är känd för att ubikvitinera MHC klass II i omogna dendritiska celler, vilket främjar nedbrytning och förhindrar handel med plasmamembranet 28 . Men en roll för MARCH1 i regleringen av metabolism eller insulinsignalering har inte till vår kunskap beskrivits.

Två andra ubiquitin-ligaser identifierades och validerades som repressorer av insulinsignalering av vår RNAi-skärm: MARCH9 och NHLRC1 . Eftersom MARCH1 , till skillnad från MARCH9 och NHLRC1 , visade uppreglering i fetma, var det fokus för den nuvarande studien. MARCH9 och NHLRC1 kan emellertid också reglera cellulär insulinverkan, kanske genom direkt ubikitinering av INSR. Även om MARCH8 , inte MARCH9 , är den MARCH- familjemedlem som är nära släkt med MARCH1 (ref. 31), kan vi inte utesluta möjligheten att MARCH9 (eller NHLRC1 ) agerar genom en liknande mekanism som MARCH1 .

Andra ubiquitin-ligaser har visat sig ubikvitinera insulinreceptorn. Mest framträdande bland dessa är CBL, som rekryteras till det aktiverade INSR (och till andra aktiverade receptortyrosinkinaser), vilket markerar det för internalisering och nedbrytning 18, 21 . Ubiquitin-ligaset NEDD4 deltar också i en ligand-inducerad repression av insulinsignalering genom att ubikitinera INSR genom adapterproteinet GRB10 19, 21, 34, 35 . RING E3-ligaset MG53 har föreslagits för att ubikvitinera INSR i skelettmuskeln, även om detta är kontroversiellt 17, 19 .

However, surprisingly, we find that the mechanism by which MARCH1 regulates INSR activity differs significantly from these established paradigms. Whereas CBL and NEDD4 function in negative feedback loops that are activated after insulin stimulation, MARCH1 appears to act in the basal state to tune cellular insulin sensitivity. In our studies of cells expressing MARCH1 shRNA, surface INSR content was increased most prominently in the basal, serum-starved state. Indeed, our measurements of surface INSRβ half-life in cells expressing MARCH1 shRNA revealed differences only in the basal state, not during insulin stimulation. These data are consistent with a model in which MARCH1 regulates the constitutive process of receptor turnover rather than the insulin-stimulated process of internalization and degradation of phosphorylated receptors. This interpretation is further substantiated by previous studies demonstrating that MARCH1 can alter the fate of endocytosed membrane proteins to favour degradation over recycling 36 .

MARCH1 regulation of INSR signalling is unlike regulation by CBL and NEDD4 in another significant way: it appears to function in a positive feedback loop. Specifically, we observed that insulin acutely decreases MARCH1 expression through a canonical FOXO1-mediated mechanism. This would tend to promote increased surface INSR content after insulin stimulation, though with the requisite time delay associated with transcriptionally mediated processes. Such a delayed mechanism could serve an important physiological role by counteracting the acute ligand-stimulated internalization and degradation of activated INSR (itself a ubiquitin-mediated process through CBL and NEDD4). In this way, insulin regulation of MARCH1 could contribute to the resetting of cellular insulin sensitivity in the postprandial state. The dysregulation of FOXO1 that accompanies insulin resistance is reflected in our observation that MARCH1 expression is increased in WAT from obese adolescent humans. Such an effect would exacerbate insulin resistance and is consistent with the well-established decreased surface INSR content in adipocytes from obese humans 37, 38 . However, because FOXO1 dysregulation must precede dysregulation of insulin control of MARCH1, this phenomenon is likely to be consequence rather than cause of insulin resistance.

Our observation that plasma membrane INSR content is increased in cells expressing MARCH1 shRNA is congruent with our insulin dose–response data. Although the plasma membranes of insulin-responsive cells have long been appreciated to contain 'spare receptors' such that a maximal insulin signalling response can be achieved with only a small fraction of receptors occupied, alterations in surface INSR content are well established to affect insulin signalling at submaximal insulin concentrations 9, 39, 40, 41 . This prediction matches our experimental data, which show increased INSR signalling at submaximal insulin doses (in effect, decreasing the physiological ED 50 for insulin action) without any increase in maximal insulin responsiveness at higher insulin doses. It is interesting to note that this left shift, despite not increasing maximal insulin responsiveness, significantly improved glucose tolerance and insulin sensitivity in mice treated with the March1 ASO and in March1 −/− mice. These results, especially considering the modest effectiveness of the March1 ASO (60 and 80% knockdown in liver and WAT, respectively), suggests that enhanced insulin sensitivity even only at suboptimal insulin levels can cause significant improvements in whole-body metabolism.

Our study also has some limitations. A major challenge for investigations of MARCH1 biology is its extraordinarily low protein expression, thought to be a consequence of autoubiquitination 23 . As a result, our data linking MARCH1 levels to metabolic phenotypes are based on mRNA expression rather than the more relevant protein expression. This phenomenon also prevented interrogation of the MARCH1-INSR interaction in mouse liver. In addition, although we observed significant MARCH1 upregulation in WAT from obese insulin-resistant human adolescents, the quantitative contribution of this upregulation to cellular insulin action is uncertain. Another caveat is that because our study focused on classical insulin target tissues such as liver and WAT, the role of other cell types with high MARCH1 expression (for example, antigen-presenting cells) was not examined in our mouse metabolic phenotyping studies. Finally, all mechanistic studies presented in this study were performed in cultured cells. Further work is needed to determine if these mechanisms, particularly MARCH1 ubiquitination of INSRβ, are operative in vivo .

Our results have broad significance for understanding insulin action and resistance in health and disease. First, the mechanism by which MARCH1 regulates INSR represents a new paradigm for E3 ligase—INSR interactions. Rather than functioning in an insulin-activated negative feedback loop, MARCH1 appears to act in the basal state to control the gain of insulin action. Second, analysis of mouse and human WAT revealed that MARCH1 expression is inappropriately increased in obesity. This, paired with our observation that insulin normally represses MARCH1 expression, proposes a mechanism for the long-observed but incompletely understood phenomenon of surface INSR downregulation in insulin resistance 9, 40, 41 : de-repression of MARCH1. Taken together, our data highlight the utility of unbiased, large-scale screens to uncover novel regulators of cellular pathways and suggest that despite intense interest in targeting downstream effectors of insulin action, the insulin receptor itself may be a tunable locus of control for insulin resistance and T2D.

metoder

RNA interference screen

HeLa cells were transduced with three lentiviral shRNA pools containing 2, 833 shRNAs against 616 E3 ligase genes or NS shRNA in triplicate at 0.2 multiplicity of infection (MOI) to prevent superinfection and to ensure that each cell received no more than one shRNA. After infection, HeLa cells were selected with puromycin (0.2 μg ml −1 ) for 7 days to enrich for HeLa cells expressing shRNA. After puromycin selection, HeLa cells were grown in serum-free DMEM containing trace elements (D0547, Sigma) supplemented with 50 ng ml −1 EGF (E9644, Sigma), 20 ng ml −1 FGF (SRP3043, Sigma), 100 nM hydrocortisone (H0888, Sigma), 0.5 μg ml −1 transferrin (T1147, Sigma), 5 ng ml −1 selenium (S5261, Sigma), 0.5 μg ml −1 fibronectin (F1141, Sigma) and 0.05 μg ml −1 insulin (I0516, Sigma). Media was changed every 3 days and cells were split at a 1:4 ratio every 7 days. After four passages all cells carrying NS and shRNAs from pool 2 were dead. Surviving cells from pools 1 and 3 were collected and genomic DNA was isolated. The integrated shRNAs were PCR-amplified using primers specific to the shRNA vector (pLKO.1) and listed in Supplementary Table 3. Samples were sequenced using primer SP6 (Supplementary Table 3) to identify candidate shRNAs.

Cell culture, plasmids and cloning

Authenticated ATCC cell lines HepG2 and HeLa were purchased from ATCC (HepG2, ATCC # HB-8065 and HeLa, ATCC # CCL-2). HepG2 and HeLa were grown in DMEM containing 10% FBS at 37 °C at % CO2. 3T3-L1 cells (ATCC # CL-173) were a kind gift from Dr. Jonathan Bogan (Yale University). 3T3-L1 cells were maintained in DMEM containing 10% calf serum. All cell lines were tested for mycoplasma contamination by ATCC using Hoechst DNA staining method, agar culture and a PCR-based assay. All cell lines were verified by ATCC using short tandem repeat profiling analysis. Differentiated 3T3-L1 adipocytes were maintained in DMEM with 10% FBS and 1 μg ml −1 insulin for 5-11 days before study. The plasmids pCDNA3.1 MARCH1-YFP, MARCH1ΔRING-YFP, MARCH1ΔCyto-YFP, MARCH1ΔC-Term-YFP, pCDNA3.1 MARCH1-Myc were as described 37, 23 . hIR-GFP was obtained from Joseph Bass (Addgene #22286). The human MARCH1 promoter (2.3 kb upstream of the transcription start site) was PCR-amplified and cloned into plasmid pGL4.14 (GE Lifesciences) between KpnI and XhoI. pcDNA GFP FKHR and pcDNA GFP FKHR AAA (constitutively active) were obtained from William Sellers (Addgene #9022, #9023). pcDNA4 myc PGC-1α was obtained from Toren Finkel (Addgene #10974).

Site-directed mutagenesis

hIR K1079R-GFP was generated through site-directed mutagenesis of hIR-GFP using specific primers (Supplementary Table 3). The FOXO1-binding site ' GTAAACA ' (-1, 343 to -1, 337 transcription start site) was mutated to ' GTACCA ' using specific primers (Supplementary Table 3). Specific deletions of the first and second transmembrane domains of MARCH1 were achieved with specific deletion primers. shRNA-resistant MARCH1 cDNAs were generated using shRNA#1 or shRNA#2-specific primers by mutating the third base of the amino acid codons without altering the amino acid composition at the shRNA-targeting sites. All site-directed mutagenesis reactions were performed using Quikchange II (Agilent) as per the manufacturer's protocol.

RNA purification, cDNA synthesis and qPCR

Total mRNA was prepared using TRIzol (Life Technologies) and purified using RNeasy mini columns (Qiagen). For mRNA expression analyses, cDNA was generated using the M-MuLV First Strand cDNA Synthesis kit (New England Biolabs). Quantitative real-time PCR was performed using Power SYBR Green kit (Applied Biosystems). Primers used for analysing mRNA expression are listed in Supplementary Table 3.

shRNAs and lentivirus preparation

pLKO.1 lentiviral vector-based shRNAs against candidate genes and non-silencing shRNA were obtained from OpenBiosystems. shRNA and siRNA information are provided in Supplementary Table 4. Lentivirus particles were prepared using 293 T cells by transfecting either gene-specific shRNA or non-silencing shRNA plasmids along with the lentiviral packaging plasmids as described ( //www.broadinstitute.org/rnai/trc/lib). All lentiviral transfections were performed using Effectene (Qiagen). Stable cell lines were generated by infection with lentivirus particles and selected with puromycin to enrich for infected cells.

Antibodies and immunoblot analysis

Whole-cell protein extracts were prepared using IP lysis buffer (Pierce) containing protease inhibitor cocktail (Roche) and phosphatase inhibitor cocktail (Sigma). Protein concentration was estimated using the Bradford assay (Bio-Rad). Proteins were separated onto 10 or 12% polyacrylamide gels and transferred onto polyvinylidene difluoride membrane by wet transfer. Polyvinylidene difluoride membranes were blocked with 5% nonfat dry milk or 5% BSA, washed, probed with primary antibodies, washed, and incubated with horseradish peroxidase-conjugated secondary antibodies (GE Healthcare). Immunoblots were developed using Supersignal Pico or Femto reagent (Pierce), as needed. Primary antibodies used are listed in Supplementary Table 3. Uncropped images of all western blots are provided along with size markers in Supplementary Fig. 12. In case of multiple bands the relevant bands are boxed in red.

Luciferase reporter assay

HeLa cells were transfected with wild-type MARCH1 reporter or FOXO1-binding site mutant MARCH1 reporter; either empty vector, pcDNA GFP FKHR or pcDNA GFP FKHR AAA (constitutively active); and either empty vector or pcDNA4/MYC-PGC-1α as indicated. Twenty-four hours after transfection, cells were serum starved overnight. Cells were stimulated with insulin (5 μg ml −1 ) or left untreated for 2 h, then lysed. The luciferase reporter assay was performed using a dual luciferase assay kit (Promega). pRL-TK was used as transfection control. Relative reporter activity was measured as ratio of firefly to renilla luciferase activity after setting vector co-transfected and non-insulin stimulated cells to 1.

ChIP assays

ChIP was performed as described previously 42 . Briefly, HeLa cells that were either insulin-stimulated (5 μg ml −1 ) or untreated for 2 h following serum starvation were fixed with 1% formaldehyde and lysed in SDS lysis buffer (1% SDS, 50 mM Tris-HCl (pH 8.0), 10 mM EDTA and protease inhibitor cocktail (Roche)). Following lysis, chromatin was sheared by sonication and immunoprecipitated with FOXO1 antibody (Supplementary Table 3). Chromatin was eluted after low-salt, high-salt and LiCl 2 wash. DNA was precipitated after reversal of crosslinking at 65 °C. Quantitative PCR was performed using primers listed in Supplementary Table 3. Fold enrichment was calculated as the ratio of immunoprecipitated DNA to input DNA.

In vitro ubiquitination assay

The in vitro ubiquitination assay was performed using a ubiquitin conjugation initiation kit (Boston Biochem). MARCH1-YFP or MARCH1ΔRING-YFP immunoprecipitated from HeLa cells was used as E3. The reaction was carried out in a final volume of 20 μl, to which 10 μl of IgG beads were added. 500 ng of GST-tagged insulin receptor kinase domain, residues 941-1343 (Enzo) was used as substrate. One microgram of purified E2 enzyme UBE2R1 (Ubiquigent) was used in each reaction. Ubiquitination reaction products were resolved by 6% PAGE and immunoblotted for INSRβ.

In vivo ubiquitination assay

HeLa cells expressing NS or MARCH1 shRNAs were transfected with HA-ubiquitin expression vectors or left untransfected and serum starved. MG132 (10 μM) was added 4 h before lysis. Cells were lysed in IP lysis buffer (Pierce) containing 100 mM N -ethylmaleimide (NEM). Immunoprecipitation was performed with isotype control IgG or Anti-HA or Anti-Ubi (FK2) antibodies and the product were analysed for ubiquitinated INSRβ by immunoblotting. The immunoprecipitate was also analysed for total ubiquitinated or HA-ubiquitinated proteins, depending on the antibody used for ubiquitin immunoprecipitation. To measure rescue of INSR ubiquitination with shRNA-resistant MARCH1 cDNA, HeLa cells expressing NS or MARCH1 shRNA were transfected with INSR-GFP and HA-ubiquitin expression vectors and empty vector or corresponding shRNA-resistant MARCH1 cDNA. Immunoprecipitation was performed with IgG or anti-HA antibodies and the product was analysed for ubiquitinated INSRβ by immunoblotting with anti-GFP antibody. For analysis of INSRβ ubiquitination with MARCH1 overexpression, HeLa cells were transfected with INSR-GFP, HA-Ubiquitin and either empty vector or MARCH1 -Myc WT or MARCH1 ΔRING-Myc and the samples were processed as above. Reciprocally, ubiquitination assays were also performed by immunoprecipitation with anti-INSRβ or anti-GFP antibody as indicated followed by immunoblotting with anti-HA antibody. The INSRβ or INSRβ-GFP immunoprecipitates treated with USP2 enzyme were analysed for INSRβ or INSRβ-GFP (ref. 43).

Liquid chromatography/mass spectrometry (LC/MS) analysis

HeLa cells were transfected with empty vector, MARCH1-Myc, or MARCH1ΔRING-Myc along with INSR-GFP and HA-Ubiquitin. Twenty-hour after transfection, cells were serum starved overnight. MG132 was added 4 h before lysis in Co-IP Buffer (Pierce). INSR-GFP was immunoprecipitated using anti-GFP antibody and eluted in 200 μl 0.2 M glycine, pH 2.5. The eluate was partially dried to ∼ 100 μl and precipitated with MeOH:CHCl 3 :Water (4:1:3 ratio). The pellet was dried and reconstituted in 8 M urea, 0.4 M ammonium bicarbonate, reduced with DTT, and alkylated with iodoacetamide in the dark. The sample was then trypsin-digested overnight at 37 °C. The digested sample was injected onto a Q-Exactive Plus (Thermo Fisher) liquid chromatography–tandem mass spectrometry system equipped with a Waters Symmetry C18 180 μm × 20 mm trap column and a 1.7 μm, 75 μm × 250 mm nanoACQUITY UPLC column (37 °C) for peptide separation. Trapping was performed at 5 μl min −1, 99% Buffer A (100% water, 0.1% formic acid) for 3 min. Peptide separation was performed with a linear gradient over 140 min at a flow rate of 300 nl min −1 . Collected data were processed using MASCOT Distiller and Search Engine (v.2.4), and modification sites were manually verified.

Flow cytometry analysis

Fluorescence-activated cell sorting analysis of cell surface INSR was performed using antibody against INSRα (Pierce) as per manufacturer's protocol. Briefly, overnight serum starved HeLa cells carrying either NS or MARCH1 shRNA left untreated were fixed with 2% paraformaldehyde followed by blocking with 1% BSA and primary antibody staining at 1:100 dilution (Supplementary Table 3). Alexa 488-conjugated IgG (Invitrogen) was used as secondary antibody at 1:200 dilution and staining intensity was measured using a FACSCalibur Analyzer (BD Biosciences).

Biotinylation and giant plasma membrane vesicle assays

Biotinylation assays were performed on overnight serum starved cells using the Cell Surface Protein Isolation Kit (Pierce) according to the manufacturer's instructions. For biotinylation assays to measure insulin induced INSR membrane trafficking, HeLa cells carrying NS or shRNAs against MARCH1 or CBL or NEDD4 were used. Cells were overnight serum starved and either left untreated or insulin treated for 3 h at an insulin concentration of 5 μg ml −1 insulin.

GPMVs were isolated as described previously 44 . GPMVs were lysed in Laemmli SDS–polyacrylamide gel electrophoresis buffer and analysed by immunoblotting for INSRα, INSRβ and Na-K ATPase. To measure the effect of Dynasore on plasma membrane INSR expression, HeLa cells carrying indicated shRNAs were serum starved overnight and were treated with DMSO or 20 μM Dynasore. One of these groups were stimulated for 3 h with 5 μg ml −1 insulin.

For half-life estimation of cell surface INSR, HeLa cells were seeded as above and after overnight serum starvation 100 μg ml −1 of cycloheximide was added with or without 5 μg ml −1 insulin. GPMVs were collected at indicated time points. In parallel, whole-cell lysates were collected at the indicated time points. GPMVs and lysate were analysed for INSRβ and Na-K ATPase levels. The densitometry values of cell surface INSRβ normalized to Na-K ATPase were graphed and half-life was calculated for periods of linear steady state degradation from 8 to 32 h for insulin-free and 0 to 16 h for insulin-treated conditions.

Co-immunoprecipitation assay

HeLa or HepG2 cells either untransfected or transfected with MARCH1 or MARCH1 deletion constructs were treated with 5 μM MG132 overnight. Cells were lysed in IP Lysis buffer (Pierce) and lysates were used for immunoprecipitation with IgG or anti-INSRβ antibody and protein G-agarose beads (Invitrogen). For co-immunoprecipitation of mutant INSRβ and MARCH1, HeLa cells were transfected with INSR-GFP or INSR K1079R-GFP along with MARCH1-Myc. INSRβ-GFP was immunoprecipitated with either IgG or anti-GFP antibody and analysed by immunoblot for indicated proteins. To avoid interference of antibody heavy chain in immunoblot wherever possible, antibodies for immunoprecipitation and immunoblot raised in different species were chosen. Primary antibodies used are listed in Supplementary Table 3.

Glycogen synthesis assay

A total of 5 × 10 5 HeLa, differentiated 3T3-L1 adipocytes or HepG2 cells were serum starved overnight and treated with 0.05 μg ml −1 insulin for 30 min or left untreated. Cells were washed twice in ice-cold PBS, scraped in 100 μl of water and boiled for 5 min. To 25 μl of cell lysate, 25 μl of 0.1 M sodium acetate containing 0.4 mg ml −1 amyloglucosidase was added. The reaction was incubated at 37 °C for 90 min. One hundred microlitre of glucose oxidase reaction mix (Sigma) was added and reactions were incubated for 30 min at 37 °C. The reaction was stopped by adding 100 μl 12 N H 2 SO 4 and absorbance was measured at 540 nm. Total glycogen was calculated using a standard curve of glycogen. Relative glycogen synthesis was calculated by normalizing to non-insulin stimulated cells carrying NS shRNA.

Glucose uptake assay

HeLa cells, HepG2 cells or differentiated 3T3-L1 adipocytes in 12-well plates were incubated in low glucose media (5 mM glucose) for 2.5 h followed by glucose-free media with or without 100 nM insulin for 30 min. 0.2 μCi of [1- 14 C]-2-deoxyglucose (2-DG) and 200 μM nonradioactive 2-DG were added to each well and incubated for 2.5–5 min at room temperature. The reaction was terminated by adding 2-DG to 200 mM. The plates were washed thrice in ice-cold PBS and cells were scraped in 500 μl deionized water. 14 C radioactivity was assessed by scintillation counting. Relative glucose uptake rate was calculated by setting non-insulin stimulated cells carrying NS shRNA as 1.

Sucrose gradient fractionation

Subcellular fractions enriched for lipid rafts and caveolae were prepared by discontinuous 5–45% sucrose gradient ultracentrifugation as described previously 45 . Fractions collected from the top of the gradient were boiled in Laemmli SDS–polyacrylamide gel electrophoresis sample buffer and analysed for INSR and marker protein content by immunoblotting.

djur

All experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Yale University School of Medicine before study initiation. Male 12–16-week-old C57BL/6 J mice were obtained from the Jackson Laboratory for ASO and AAV studies and studied at 14-20 weeks of age. March −/− mice were previously generated 27 on the C57BL/6 background and were maintained with heterozygote breeders so that littermate wild-type controls could be used for metabolic studies. March1 −/− mice were studied at 12–20 weeks of age. Mice received free access to food and water and were housed with 12 h light/dark cycles (0700–1900 hours) at 23 °C. Diets used were: regular chow (Harlan Teklad TD2018S, 18% fat, 58% carbohydrate, 24% protein); HFD (Research Diets D12492, 60% fat, 20% carbohydrate, 20% protein). For studies of candidate gene expression in obesity, mice were fed HFD for 4 weeks. For all animal studies, sample sizes were selected to yield 90% power (at α =0.05) to detect 20% differences in metabolic parameters with an expected sd of 10%. Mice were randomly allocated to experimental groups, and weight-matching was ensured before beginning experimental protocols. Investigators were not blinded to treatment group during studies.

Second-generation antisense oligonucleotide treatment

2'- O -methoxyethyl chimeric ASOs targeting MARCH1 were synthesized as described 46 and screened in mouse hepatocytes for target knockdown. Three candidate sequences were tested in mice. The most potent and nontoxic candidate was ISIS 671547, with the sequence 5′- GGCTCTGCTAACCAATATTC -3′. This ASO was used in all subsequent studies. The control ASO, ISIS 141923, has the sequence 5′- CCTTCCCTGAAGGTTCCTCC -3′ and is not complementary to any known mouse gene. ASO solutions in phosphate buffered saline were injected intraperitoneally biweekly at a dose of 75 mg kg −1 wk −1 for 2 weeks.

Adeno-associated virus (AAV) treatment

Mouse MARCH1 cDNA, isoform 3 (Origene) was cloned into the pscAAV2CB6 vector plasmid. AAV was produced as described previously using standard 293 cell triple transfection and CsCl gradient purification techniques 47 . Control AAV was scAAV8.CB6.eGFP. AAV was delivered by tail vein injection at 7.5 × 10 11 genome copies per mouse. Mice were studied 4 weeks after AAV treatment to achieve maximal expression.

Intraperitoneal glucose tolerance tests

Awake mice fasted 8 h (for March1 ASO studies in male mice) or overnight (for March1 −/− studies in female mice) were placed under gentle tail restraint and injected intraperitoneally with 10% glucose solution at 1 mg g −1 (for March1 ASO studies in male mice) or 2 mg g −1 (for March1 −/− studies in female mice). For the next 120 min, plasma was collected at regular intervals by tail massage for determination of plasma glucose and insulin concentrations.

Hyperinsulinemic-euglycemic clamp studies

Jugular venous catheters were placed 6–9 days before study. Clamp studies and calculations were performed as previously described 48 and in compliance with the standard operating procedures of the NIH Mouse Metabolic Phenotyping Centers (MMPC) 49 . Only mice that recovered to >90% of their preoperative body weight were studied. After fasting (6 h for March1 ASO and March1 AAV studies; 12 h for March1 −/− studies), awake mice under gentle tail restraint received a 120 min infusion of [3- 3 H]-glucose (0.05 μCi min −1 ) to measure basal glucose turnover. The hyperinsulinemic-euglycemic clamp lasted 140 min and was started with a 14.3 mU kg −1 prime bolus of insulin (Novolin, Novo Nordisk) delivered over 3 min followed by a continuous insulin infusion of 2 mU kg −1 min −1 (for March1 ASO and chow-fed March1 −/− studies) or 21.5 mU kg −1 prime/3 mU kg −1 min −1 continuous (for March1 AAV and HFD-fed March1 −/− studies). 20% glucose was infused at a variable rate to maintain euglycemia (100–120 mg dl −1 ) with [3- 3 H]-glucose added at a target infusion rate of 0.1 μCi min −1 (hot-GINF) to measure insulin-stimulated glucose turnover. Plasma was collected by tail bleeding for determination of plasma glucose, insulin, NEFAs and 3 H-glucose specific activity. At the completion of the clamp study, mice were anaesthetized with pentobarbital sodium (150 mg kg −1 ). Tissues were rapidly harvested and snap-frozen in liquid N 2 with pre-cooled clamps.

Plasma measurements

Plasma glucose was measured using a YSI Biochemistry Analyzer (Yellow Springs Instruments). Plasma insulin was measured by radioimmunoassay (Linco). Plasma NEFAs were measured enzymatically (NEFA-HR, Wako). Plasma transaminase activity was measured by COBAS.

Human adipose qPCR

WAT biopsies from lean and obese human adolescents were collected with written informed consent and Yale University Human Investigation Committee approval as part of the Yale Pathophysiology of T2D in Obese Youth Study 50 . Patients were stratified into lean (BMI30) groups. A total of 1–2 g abdominal subcutaneous adipose tissue biopsies were collected inferior to the umbilicus after local lidocaine anaesthesia. RNA was isolated using the Qiagen Lipid Tissue Kit and cDNA synthesized using the M-MuLV First Strand cDNA Synthesis kit (New England Biolabs). Quantitative real-time PCR was performed using an Applied Biosystems 7500 Fast system.

Statistisk analys

All values are expressed as the mean±sem The significance between the mean values for each study was evaluated by two-tailed unpaired Student's t -test (for comparisons of two groups) or analysis of variance (for comparisons of more than two groups) with the Holm–Sidak correction for multiple comparisons. Variance was calculated to be similar between groups compared.

Data tillgänglighet

All relevant data are available from the authors on request and/or are included with the manuscript (as figure source data or Supplementary Information files).

Kompletterande information

PDF-filer

  1. 1.

    Kompletterande information

    Supplementary Figures 1-12 and Supplementary Tables 1-4

kommentarer

Genom att skicka en kommentar samtycker du till att följa våra villkor och gemenskapsriktlinjer. Om du finner något missbruk eller som inte överensstämmer med våra villkor eller riktlinjer ska du markera det som olämpligt.