Hämning av hif-la med anticancerläkemedlet tas106 förbättrar röntgeninducerad apoptos in vitro och in vivo | brittisk journal för cancer

Hämning av hif-la med anticancerläkemedlet tas106 förbättrar röntgeninducerad apoptos in vitro och in vivo | brittisk journal för cancer

Anonim

Den här artikeln har uppdaterats

Abstrakt

I en tidigare studie visade vi att ett nytt läkemedel mot cancer, 1- (3-C-etynyl- p- D- ribo- pentofuranosyl) cytosin (TAS106, ECyd) ökade antitumoreffekten av X-bestrålning. Effekterna på hypoxiska celler i tumörer förblir emellertid oklarade. Här visar vi att TAS106 förbättrar induktionen av apoptos i X-bestrålade humana gastriska adenokarcinom MKN45- och MKN28-celler under hypoxi in vitro . Samtidigt visade sig ackumuleringen av HIF- 1a som observerades under hypoxi minskas till nivån av normoxi i närvaro av 0, 1 μM TAS106. För att studera HIF-1 a- proteinets funktion i apoptos av hypoxiska celler använde vi en HIF-1 a- reduktiv metod med dess specifika antisense-oligodeoxynukleotid. Reduktionen av HIF-1 a- genuttryck förbättrade dramatiskt röntgeninducerad apoptos i hypoxiska celler. I experiment in vivo där MKN45-celler transplanterades i svåra kombinerade immunodeficienta (SCID) -möss, undertryckte TAS106 (0, 5 mg kg-1) HIF- 1a- uttryck och minskade därefter området för den hypoxiska regionen i tumören och förstärkte induktionen av apoptos i den hypoxiska regionen i kombination med 2 Gy X-bestrålning. Dessa resultat antyder möjligheten att TAS106 fungerar som en potent radiosensibiliserare genom hämning av HIF- 1a- uttryck och kan vara ett användbart medel mot radioterapiresistenta hypoxiska celler i solida tumörer.

Huvudsaklig

Det ribonukleosid-anticancerläkemedlet 1- (3-C-etynyl- p -D-ribo-pentofuranosyl) cytosin (TAS106, ECyd) som visas i figur 1A syntetiserades först 1995 och har utvecklats som ett nytt läkemedel mot cancer (Hattori et al, 1996). När TAS106 (ECyd) intas i tumörceller fosforyleras det snabbt till ECyd 5'-trifosfat, vilket har potential att hämma RNA-syntes på grund av dess hämning av RNA-polymeras, vilket leder till celldöd (Shimamoto et al, 2002; Matsuda och Sasaki, 2004). Uridin / cytidinkinas (UCK) är ett viktigt enzym för den första fosforyleringen av TAS106 till ECyd 5'-monofosfat, vilket alstrar cytotoxicitet. Den höga aktiviteten av UCK i tumörceller relativt normala celler (Maehara et al, 1982; Koizumi et al, 2001; Matsuda och Sasaki, 2004) ger TAS106 en fördel i specificitet för tumörterapi. I tidigare studier har vi visat att både apoptos och förlust av klonogen överlevnad induceras genom upphävandet av gripande vid G2 / M-fasen i X-bestrålade humana (MKN45 och MKN28) och murina (Colon26) tumörceller, såväl som Kinesiska hamster V79-normala celler, när X-bestrålning kombineras med TAS106-behandling in vitro (Inanami et al, 2004; Iizuka et al, 2005). De radiosensibiliserande effekterna av TAS106 sågs också i kolon26-transplanterade tumörer och MKN45-xenografter in vivo (Yasui et al, 2007). Intressant nog visade vår tidigare studie att repetitiva behandlingar (tre gånger med 2-dagars intervall) med kombinationen av X-bestrålning och TAS106 inducerade tumörremission hos hälften av mössen, medan behandlingen med X-bestrålning ensam eller TAS106 enbart visade endast liten retardering av tumörtillväxt utan tumörremission Detta resultat antydde möjligheten att TAS106 radiosensibiliserade hypoxiska celler utöver normoxiska celler.

1- (3-C-etynyl- p- D- ribo -pentofuranosyl) cytosin (TAS106, ECyd) förbättrar röntgeninducerad apoptos i MKN45- och MKN28-celler under normoxi och hypoxi. ( A ) Den kemiska strukturen för TAS106. ( B ) MKN45 (a) och MKN28-celler (b) behandlade med TAS106 (0, 1 och 1, 0 mikrometer för MKN45 respektive MKN28) och / eller 20 G X-bestrålning inkuberades under de angivna tiderna under antingen normoxi eller hypoxi. Apoptotiska celler (%) mättes med fluorescensmikroskopi av celler färgade med propidiumjodid. Data uttrycks som medelvärde ± se för tre experiment. * P <0, 05 vs kontroll, ** P <0, 01 vs kontroll. ( C ) Cellcykelanalys av MKN45-celler behandlade med TAS106 och / eller X-bestrålning. Efter inkubation under antingen normoxi eller hypoxi under 48 timmar uppsamlades celler, fixerades och färgades med propidiumjodid. DNA-innehållet mättes med flödescytometri, och därefter poängsattes procentsatserna av cellpopulationer i sub-G1-fraktionerna av totala celler som medelvärde ± se ( D ) Effekter av X-bestrålning och TAS106-behandling på aktiveringen av caspase-3 i MKN45-celler. Tumörceller uppsamlades 48 timmar efter varje behandling. Pilarna indikerar de aktiverade p19- och p17-fragmenten av casapse-3. Kvantifiering av bandet med p17-fragment av casapse-3 utfördes med användning av Image J-analys normaliserad till aktin.

Bild i full storlek

Hypoxiainducerbar faktor 1 (HIF-1) är en nyckelmedlare uttryckt i många celltyper som svar på syreberoende. HIF-1 a , en syrekänslig HIF-1-subenhet, spelar en viktig roll för att skydda fasta tumörer mot radio- och kemoterapi genom att främja angiogenes, öka glukosmetabolismen och modulera apoptos. I själva verket demonstrerade Koukourakis et al och Vergis et al (Vergis et al, 2008) att överuttrycket av HIF-1 a i skivepitelcancercancer och prostatacancer var associerat med ofullständiga svar på kirurgi, kemoterapi, strålterapi och kemoradioterapi och med dålig överlevnad i kliniska studier (Koukourakis et al, 2002). HIF-1 a hämmar generellt induktionen av apoptos av anticancermedel (Semenza, 2003; Kilic et al, 2007). Det har visats att HIF-1 a utövar sin antiapoptotiska funktion genom transkriptionell aktivering av antiapoptotiska proteiner, det vill säga Bcl-2-familjen och hämmare av apoptos (IAP), såsom survivalivin (Dong et al, 2003; Peng et al, 2006). I våra nyligen genomförda studier ansågs hämningen av överlevnadsuttryck med TAS106 huvudsakligen bidra till radiosensitering av apoptos och undertryckning av tumörtillväxt in vitro och in vivo (Inanami et al, 2004; Yasui et al, 2007). Således är det möjligt att antaga att TAS106 styr HIF-1 a- uttryck och resulterar i undertryckandet av antiapoptotiska proteiner, det vill säga dess transaktiverande faktorer nedströms.

För att bekräfta den ovan beskrivna hypotesen undersökte vi effekterna av TAS106 på röntgenbestrålade tumörceller under hypoxi både in vitro och in vivo med särskild tonvikt på hämningen av HIF-1 a- uttryck.

Material och metoder

material

1- (3-C-etynyl- p- D- ribo -pentofuranosyl) cytosin (TAS106) syntetiserades såsom beskrivits på annat håll (Hattori et al, 1996). Ultrapure kvävgas (99.999%) erhölls från Air Water Technical Supply (Ishikari, Japan).

Cell kultur

Celler av humant gastriskt adenokarcinomcellinje MKN45 (TP53 vildtyp) och MKN28 (TP53-mutation) odlades i RPMI 1640-medium (Gibco-BRL / Invitrogen, Carlsbad, CA, USA) kompletterat med 10% fetalt bovint serum (Filtron, Brooklyn (Australien) vid 37 ° C i 5% CO2 / 95% luft.

Cellinkubation, X-bestrålning och läkemedelsbehandling in vitro

Tumörceller bundna till en 6 cm plastskål behandlades med TAS106 i koncentrationerna av 0, 1 och 1, 0 mikrometer för MKN45 respektive MKN28-celler 1 timme före hypoxisk inkubation. Det hypoxiska tillståndet hos tumörceller i skålen (syrekoncentration <20 mmHg) uppnåddes genom att placera det i en gasutbytbar kammare och kontinuerligt passera 95% N2 / 5% CO2 under 25 minuter på is. Cellerna exponerades sedan för 20 Gy röntgenstrålar medan de upprätthöll gasflödet. Röntgenstrålning utfördes med en Shimadzu PANTAK HF-350 röntgengenerator (1, 0 mm Al-filter, 200 kVp, 20 mA, Shimadzu, Kyoto, Japan). Efter X-bestrålning stängdes kammaren tätt och inkuberades vid 37 ° C under de angivna perioderna. Celler under normoxi inkuberades också i 25 minuter på is och exponerades sedan för röntgenstrålar. Hypoxi inducerades också kemiskt genom att behandla celler med 100 μM CoCl2 under 12 timmar.

RNAi till knockdown UCK2-gen i MKN45-celler

Glödgade dubbelsträngade siRNA (Stealth Select RNAi, Invitrogen, Carlsbad, CA, USA) för UCK2- genen enligt följande: senssträng 5UAGCCGUUGAGACAGCCAUUGGUCU3 och antisense-streng 5AGACCAAUGGCUGUCAACGGCU3. Transfektion av MKN45-celler med siRNA utfördes med användning av Lipofectamine ™ 2000 enligt tillverkarens instruktioner. Som en negativ kontroll för siRNA-behandlingen användes medium GC Stealth RNAi negativ kontrollduplex (MedGC, Invitrogen).

HIF-1 a antisense oligonukleotidbehandling av tumörceller

En HIF-1 a- antisense-fosforotioatoligodeoxynukleotid (AS-HIF-1 a -ODN) och en scramble-kontroll (Srb-ODN) syntetiserades av Sigma Genosys (Ishikari, Japan) enligt publicerade sekvenser (antisense-sekvens: 5'-GCCGGCGCCCCTCC-) 3 '; krypteringssekvens: 5'-ATGGAGGGCGCCGGC-3'; Zhang et al, 2004a). MKN45-celler exponerades för antingen Srb-ODN eller AS-HIF-1 a -ODN förblandad med lipofectamine ™ 2000. För att bedöma transfektionseffektiviteten konjugerades 5'-ändarna av oligonukleotiderna till fluorescein-isotiocyanat (FITC). FITC-märkta oligonukleotider transfekterades till MKN45-celler under samma förhållanden som ovan, och därefter bedömdes transfektionseffektiviteten genom att räkna fluorescerande celler.

Fluorescensmikroskopiska och flödescytometriska observationer av apoptotiska celler

Detekteringen av apoptotiska celler utfördes såsom beskrivits tidigare (Inanami et al, 2004). I korthet samlades celler som inkuberades under de angivna tiderna efter X-bestrålning genom centrifugering. För fluorescensmikroskopi färgades celler fixerade med 1% glutaraldehyd med 40 mikroliter propidiumjodid (SIGMA Chemical Company, St Louis, MO, USA). Fluorescensmikroskopisk observation utfördes med användning av ett Olympus BX50-mikroskop (Olympus, Tokyo, Japan). Fraktionen av apoptotiska celler beräknades som procentandelen apoptotiska celler relativt den totala celler som observerades mikroskopiskt. Tre oberoende experiment utfördes.

För flödescytometrisk analys uppsamlades tumörceller 48 timmar efter X-bestrålning och fixerades med 70% etanol. Efter att ha reagerat med RNase A (Roche Diagnostics, Mannheim, Tyskland) i 30 minuter färgades cellerna med 50 μg ml-1 propidiumjodid. DNA-innehållet i 10 000 celler analyserades med användning av en EPICS ALTRA-flödescytometer (BECKMAN COULTER, Fullerton, CA, USA).

Klonogen överlevnadsanalys

Den överlevande fraktionen i MKN45- och MKN28-celler, som bestod av vidhäftande celler och flytande celler, analyserades med användning av plasmatpropptekniken med blodplättsfattig human plasma enligt metoden beskriven av Kashiwakura et al (Kashiwakura et al, 2002). I korthet samlades cellerna med eller utan TAS106 under 24 timmar efter X-bestrålning genom trypsinisering. Rätt antal (100–20 000) tumörceller med 10% humant blodplättsfattig AB-plasma, tillväxtfaktorn (erna), penicillin (100 U ml −1 ), streptomycin (100 μg ml −1 ), natriumpyruvat ( 1 mM), MEM-vitaminer (1%), MEM icke-essentiella aminosyror (1%), tioglycerol (10 μM ), L-asparagin (2 μg ml −1 ), CaCl2 (74 μg ml - 1 ) och 0, 2% bovint serumalbumin i Iscoves modifierade Dulbeccos medium (Invitrogen) pläterades i 24-brunnars odlingsplattor och inkuberades vid 37 ° C i 5% CO 2 /95% luft under 14 dagar (MKN45) och 10 dagar (MKN28) ). Under ett mikroskop värderades kolonier innehållande mer än 50 celler som överlevande celler och den överlevande fraktionen vid varje dos beräknades med avseende på pläteringseffektiviteten hos den icke bestrålade kontrollen. Medlet för att överleva fraktioner från tre experiment planerades till dos-svarskurvor.

SDS – PAGE och immunblotting

Celler uppsamlades vid de angivna perioderna efter X-bestrålning och lyserades i lysbuffert (25 m M Tris-HCl, pH 7, 4; 300 m M NaCl; 10% glycerol; 3 m M EDTA; 1 m M MgCl2; 50 mM P- glycerofosfat; 25 m M NaF; 1% Triton X-100 och proteasinhibitorcocktail). Immunoblot-analys utfördes som tidigare beskrivits (Iizuka et al, 2005). Följande antikroppar användes: anti-HIF-1 a (BD Transduction Laboratories, San Diego, CA, USA), antikaspas-3 (8G10; Cell Signaling Technology, Beverly, MA, USA), anti-UCK2 (ab37886; Abcam Inc ., Cambridge, MA, USA), anti-cIAP2 (58C7; Cell Signaling Technology), antisurvivin (Alpha Diagnostic, San Antonio, TX, USA), anti-VEGF (Lab Vision Corp., Fremont, CA, USA) och antiactin (Santa Cruz bioteknik). Bandet kvantifierades med Image J-programvaran (National Institutes of Health, Bethesda, MD, USA).

Semikantitativ omvänd transkription - PCR (RT – PCR)

Totalt RNA extraherades och renades med ett RNeasy Mini-kit (Qiagen, Hilden, Tyskland) enligt tillverkarens instruktioner. De specifika primersekvenserna var följande: för HIF-la , 5'CCCCAGATTCAGGATCAGGATCAGACA3 'och 5'CCATCATGTTCCATTTTTCGC3'; för UCK2 , 5′GCGAACCATGGCCGGGGACAGCGAG3 ′ och 5′ACAGTATGTACAGATGAGCAGTGCC3 ′; för GAPDH , 5′GAAGGTGAAGGTCGGAGTC3 ′ och 5′GAAGATGGTGATGGGATTTC3 ′. Ett mikrogram RNA transkriberades omvänd med användning av Reverse Transcriptions System (Promega Corporation, Madison, WI, USA) och amplifieringsreaktioner utfördes med användning av GoTaq ™ DNA Polymerase (Promega). PCR-protokollet var som följer: initial denaturering vid 95 ° C under 2 minuter, följt av 25 cykler vid 95 ° C under 1 min, glödgning vid 53 ° C (HIF- 1a ) eller 60 ° C (UCK2 och GAPDH) för 1 min och förlängning vid 72 ° C under 1 min. Den slutliga förlängningen utfördes genom ett inkubationssteg vid 72 ° C under 5 minuter. PCR-produkterna utsattes för elektrofores i agarosgel och visualiserades med etidiumbromid.

Djur och tumörmodeller

CB-17 / Icr. SCID Jcl-möss i åldern 6 veckor köptes från Japan CLEA (Tokyo, Japan). MKN45-celler injicerades subkutant i fotstödet på det högra bakbenet (5 x 106 celler per djur).

Denna studie genomfördes enligt de fastställda riktlinjerna för "lagen för vård och välfärd för djur i Japan" och godkändes av djurförsökskommittén för Graduate School of Veterinary Medicine, Hokkaido University (godkännande nr 8092).

Läkemedelsbehandling och X-bestrålning in vivo

När tumören nådde en storlek av 350 mm 3 utfördes TAS106-administration och / eller X-bestrålning endast en gång. Djur randomiserades i fyra grupper: (1) ingen behandling, (2) X-bestrålning (2 Gy) ensam, (3) TAS106-administration enbart och (4) TAS106-administration under 3 timmar följt av X-bestrålning (2 Gy). TAS106 injicerades ip i möss i mängden 0, 5 mg kg-1. Transplanterade tumörer bestrålades med en Shimadzu PANTAK HF-350 röntgengenerator med en doshastighet av 0, 8 Gy min −1 .

Immunohistokemisk analys av hypoxiska regioner och HIF-1 a

För analys av hypoxiska regioner behandlades möss med TAS106-administration och / eller X-bestrålning när tumören nådde en storlek av 350 mm3 . Storleken på de behandlade tumörerna övervakades varje dag och möss dödades i följd när tumörstorleken nådde 700 mm3 . För att visualisera tumörhypoxi dödades möss 90 minuter efter ip-injektion av 60 mg kg-1 pimonidazolhydroklorid (Hypoxyprobe ™ -1 Kit; Chemicon International Inc., Temecula, CA, USA). Tumörvävnader som skärs ut från möss fixerades i 4% buffrad formaldehyd, inbäddade i paraffin och sektionerades 5 μm tjock. Färgningsförfarandet för tumörhypoxi var enligt instruktionerna i Hypoxyprobe ™ -1-kit.

För HIF-1 a- immunfärgning skars tumörerna ut 2 dagar efter X-bestrålning och / eller TAS106-administration. Antigenutvinning utfördes genom tryckuppvärmning i 3 minuter i 0, 01 M citratbuffert (pH 6, 0). Efter avkylning av endogent peroxidas inkuberades sektioner med en anti-HIF-1 a- antikropp (NB100-654; Novus Biologs, Littleton, CO, USA) utspädd vid 1: 1000 över natt vid 4 ° C. Därefter reagerades sliderna med EnVision + System-HRP-märkt antirabbitpolymer (K4002, Dako Cytomation, Kyoto, Japan). Immunoreaktivitet visualiserades genom inkubering med DAB. Varje färgad släde försvagades lätt med hematoxylin. Sektionerna analyserades under ett Olympus BX50-mikroskop.

Immunofluorescerande dubbelfärgning för hypoxiska celler och apoptotiska celler

Tumörvävnader som skärs ut från mössen 2 dagar efter X-bestrålning och / eller TAS106-administrering fixerades med 4% paraformaldehyd, frystes med användning av ultrakallt hexan och sektionerades 8 μm tjockt. Efter blockering av icke-specifika bindningsställen reagerades sliderna med lämplig utspädning av hypoxyprobe ™ -1 MAb1 (1: 500) och kanin-antiklövt kaspas-3 (Asp175; Cell Signaling Technology; 1: 1000) över natt vid 4 ° C. Sektionerna inkuberades med Alexa Fluor 488 antimouse och Alexa Fluor 546 antirabbit sekundära antikroppar (Molecular Probes, Eugene, OR, USA). Sedan monterades de på Prolong Gold antifade reagens med DAPI (Molecular Probes). Fluorescensmikroskopisk observation utfördes med användning av ett Olympus BX50 mikroskop med reflekterad ljusfluorescens.

Betyg av färgade sektioner

Det hypoxiska området uppskattades genom att kvantifiera förhållandet mellan det pimonidazol-positiva området och det totala området för skivan efter att ha valt en tröskel med användning av Scion Image-programvara. Kvantitativ analys för HIF- 1a utfördes genom att beräkna förhållandet mellan positivt färgade celler mot alla tumörceller förutom för nekrotiska regioner i fem slumpmässiga fält vid förstoring av 400. Dessa kvantifieringar utfördes på minst tre olika xenotransplantat i varje behandlingsgrupp.

Statistisk analys

Alla resultat uttrycktes som medelvärde ± se Variansförhållandet uppskattades av F- testet och skillnader i medel för grupper bestämdes med Student's t- test eller Welch's t- test. Minsta nivå av betydelse sattes till P <0, 05.

Resultat

TAS106 förbättrade strålningsinducerad apoptos under hypoxi såväl som normoxi på ett UCK2-beroende sätt i tumörceller

Figur IB (a) visar effekterna av kombinationen av X-bestrålning (20 Gy) och TAS106 (0, 1 μM ) på apoptotisk induktion i MKN45-celler under normoxi och hypoxi. När MKN45-celler behandlades med X-bestrålning under normoxi eller hypoxi observerades inte apoptotisk induktion förrän 48 timmar. Behandling av celler med TAS106 ensam inducerade signifikanta ökningar av apoptos vid 48 timmar under normoxi och vid 36 och 48 timmar under hypoxi. Den kombinerade behandlingen med X-bestrålning och TAS106 under normoxi förbättrade emellertid signifikant apoptos i MKN45-celler från 24 timmar och 27, 0 ± 3, 8% av cellerna var apoptotiska vid 36 timmar, liknande en tidigare rapport (Inanami et al, 2004). En signifikant ökning av apoptotiska celler observerades också under hypoxi, även om den apoptotiska induktionen var mindre än den under normoxia (18, 9 ± 3, 5% vid 36 timmar).

Figur IB (b) visar effekten av kombinationen av X-bestrålning och TAS106 på apoptotisk induktion i MKN28-celler. Behandling av 0, 1 μM TAS106 kunde inte förbättra röntgeninducerad apoptos i MKN28-celler (data visas inte), vilket tyder på att MKN28-celler med TP53-mutation var mer resistenta mot apoptotisk induktion genom röntgenstrålning och TAS106 än MKN45-celler med vildtyp TP53. Således användes 1, 0 mikrometer som dos av TAS106. TAS106 inducerade vid denna dos 20% apoptos vid 36 timmar under både normoxi och hypoxi. Förstärkt induktion av apoptos genom kombinerad behandling observerades dock jämfört med varje behandling ensam.

För att studera förhållandet mellan den strålningsinducerade cellcykelkontrollpunkten och induktionen av apoptos genom TAS106 utfördes flödescytometrisk analys (figur 1C). När MKN45-celler exponerades för 20 Gy röntgenstrålar och inkuberades under 48 timmar under antingen normoxi eller hypoxi, visade flödescytometrisk profil en markant ökning i G2 / M-fraktionen men inte i sub-G1-fraktionen, vilket antydde förekomst av strålningsinducerad G2 / M-grip utan apoptos. Dessutom inducerade behandlingen av celler med TAS106 enbart ackumulering av G1-fraktionen, men inte en ökning av sub-G1-fraktionen. Kombinationen av X-bestrålning och TAS106 resulterade emellertid i en minskning av G2 / M-fraktionen och en ökning av sub-G1-fraktionen (sub-G1-fraktion; 10, 4–25, 5% under normoxia och 10, 2–16, 7% under hypoxi). En liknande minskning av G2 / M-fraktionen och ökning i sub-G1-fraktionen med TAS106 observerades också i bestrålade MKN28-celler (data visas inte). Dessa resultat bevisade att TAS106 förbättrade strålningsinducerad apoptos under både normoxi och hypoxi oavsett skillnad i TP53-status.

Eftersom TAS106 rapporterades förbättra kaspasberoende apoptos i X-bestrålade tumörceller under normoxia (Inanami et al, 2004) undersökte vi om aktivering av caspase-3 också inducerades av den kombinerade behandlingen även under hypoxi. Såsom visas i figur 1D avslöjade immunoblotanalys att X-bestrålning i kombination med TAS106-behandling inducerade uttrycket av klyvt caspase-3 (p19 och p17, aktiva former av caspase-3) i MKN45-celler under normoxi och hypoxi. När tumörceller behandlades med TAS106 ensam eller X-bestrålning med TAS106 under hypoxi var aktiveringen av caspase-3 svagare än den under normoxia, vilket antydde att hypoxiska celler var resistenta mot kaspasmedierad apoptos.

Det har rapporterats att UCK2 är ansvarig för fosforylering av 3'-etynylnukleosider, inklusive TAS106 (Murata et al, 2004), och denna fosforylering är väsentlig för hämning av RNA-polymeras. För att bestämma engagemanget av UCK2 i TAS106-inducerad apoptos undersökte vi därför om TAS106 kunde förbättra strålningsinducerad apoptos i celler tystade UCK2- genen av RNAi. UCK2-knockdown ledde till en minskning inte bara i UCK2-mRNA-nivåer utan också proteinnivåer (figur 2A). Tystnad av UCK2 förhindrade den apoptotiska induktionen genom TAS106 / X-bestrålningsbehandling signifikant jämfört med håna-transfekterade och MedGC-transfekterade celler (figur 2B).

Förbättringen av strålningsinducerad apoptos med TAS106 upphävs genom UCK2-knockdown i MKN45-celler. ( A ) Semiconfluent MKN45-celler inkuberades med dubbelsträngad siRNA för UCK2- genen och lipofectamine ™ 2000 i frånvaro av fetalt bovint serum under 4 timmar och i följd i närvaro av fetalt bovint serum under 20 timmar. Som en negativ kontroll för siRNA-behandlingen transfekterades medellång GC-stealth RNAi negativ kontroll Duplex (MedGC) in i tumörceller istället för siRNA. MKN45-celler samlades upp 24 eller 48 timmar efter siRNA-transfektion, och sedan undersöktes UCK2-expression på mRNA-nivån och proteinnivån med RT – PCR (a) respektive genom immunblotting (b). ( B ) Efter siRNA-transfektion behandlades MKN45-celler med 0, 1 μM TAS106 och / eller 20 Gy X-bestrålning. Apoptotisk induktion i tumörceller uppsamlade 36 timmar efter varje behandling mättes med fluorescensmikroskopi av celler färgade med propidiumjodid. Data uttrycks som medelvärde ± se för tre experiment. ** P <0, 01 vs hålig kontroll.

Bild i full storlek

Effekter av TAS106 på cellöverlevnad undersökt med klonogen förmåga

Därefter undersökte vi en kolonibildningsanalys, som integrerar flera former av celldöd, såsom apoptos, nekros och mitotisk katastrof, och därmed ger övergripande celldödande som är korrelerat till tumörrespons in vivo . Överlevnadskurvorna i MKN45-celler exponerade för röntgenstrålar under normoxi eller hypoxi visas i figur 3A. I MKN45-celler utan TAS106 var den klonogena förmågan i de celler som exponerades för röntgenstrålar under normoxi (10% överlevnad; Dio = 2, 5 Gy) lägre än under hypoxi (D 10 = 3, 7 Gy). Behandlingen med 0, 1 μM TAS106 förbättrade signifikant förlusten av klonogen förmåga hos MKN45-celler exponerade för röntgenstrålar under normoxi och hypoxi (D 10 = 1, 75 Gy i normoxia + TAS106 och D 10 = 2, 75 Gy i hypoxia + TAS106). Vidare undersöktes även den klonogena förmågan hos MKN28-celler. Såsom visas i figur 3B var klonogena förmågor i MKN28-celler exponerade för röntgenstrålar utan TAS106 under normoxi (Dio = 8, 4 Gy) och under hypoxi (D 10 = 10, 9 Gy) signifikant högre än för MKN45-celler. Denna observation antydde att mutation av TP53 gjorde MKN28-celler mer resistenta mot X-bestrålning. Behandlingen med 1, 0 μM TAS106 förbättrade signifikant förlusten av klonogen förmåga hos MKN28-celler exponerade för röntgenstrålar under normoxi och hypoxi (D 10 = 5, 1 Gy i normoxia + TAS106 och D 10 = 6, 9 Gy i hypoxia + TAS106).

Dos-svarskurvor för X-bestrålade MKN45 ( A ) och MKN28 celler ( B ). Tumörceller bestrålades under normoxi (slutna cirklar), normoxia + TAS106 (slutna rutor), hypoxi (öppna cirklar) och hypoxi + TAS106 (öppna rutor; 0, 1 μM TAS106 för MKN45 och 1, 0 μM TAS106 för MKN28, respektive) . Överlevande fraktion vid varje dos beräknades och korrigerades i enlighet med pläteringseffektiviteten hos den icke bestrålade kontrollen. Data uttrycks som medel ± se för tre experiment.

Bild i full storlek

Effekter av TAS106 på uttrycket av hypoxiainducerade proteiner relaterade till apoptos

För att få insikt i moduleringen av apoptotisk resistens som svar på hypoxi i MKN45-celler analyserade vi nästa uttryck av IAP-familjeproteiner under hypoxi. Såsom visas i figur 4A ökades uttrycket av survivin och cIAP2 under hypoxi och deras uppreglering nådde den maximala nivån i MKN45-celler 24 timmar efter hypoxisk exponering. Vidare visar figur 4B att X-bestrålning inte påverkade survival och cIAP2-uttryck, medan 0, 1 μM TAS106 upphävde uppregleringen av dessa antiapoptotiska proteiner under både normoxi och hypoxi.

Immunoblots av expressionen av survivin, cIAP2, HIF-1 a och VEGF. ( A ) Tidsförloppet för överlevnad och cIAP2-expression i MKN45-celler som inkuberades under hypoxi under de angivna tiderna. ( B ) Effekter av TAS106 på uttrycket av survivin och cIAP2 under normoxi och hypoxi. MKN45-celler behandlade med 20 Gy X-bestrålning och / eller 0, 1 μM TAS106 inkuberades under 24 timmar. ( C ) Effekter av TAS106 på uttrycket av HIF- 1a och VEGF i MKN45-celler under normoxi och hypoxi. Tumörceller inkuberades under 48 timmar efter varje behandling. Kvantifiering av band av survivin, cIAP2, HIF- 1a och VEGF utfördes med användning av Image J-analys normaliserad till aktin.

Bild i full storlek

Effekter av TAS106 på HIF-1 a- och VEGF-expression i MKN45-celler under hypoxi

Eftersom hypoxi i fasta tumörer är en potent inducerare av cellöverlevnad och angiogenes genom uppregleringen av HIF-1 a- VEGF-vägen undersökte vi effekterna av TAS106 på dessa hypoxi-relaterade signalmolekyler i MKN45-celler. Såsom visas i figur 4C ökade det hypoxiska tillståndet signifikant uttrycket av HIF-1 a upp till 8, 9 gånger, medan TAS106-behandling under 48 timmar inhiberade fullständigt dess uppreglering. VEGF-proteinet uttrycktes konstitutivt i MKN45-celler under både normoxi och hypoxi och förändrades inte genom X-bestrålning. Emellertid dämpades dess uttryck markant genom behandling med TAS106 ensam eller X-bestrålning med TAS106. Dessa data visade tydligt att TAS106 störde uppregleringen av HIF-1 a- VEGF-vägen under hypoxi.

HIF-1 a- nedreglering av TAS106 är till stor del beroende av transkriptionell hämning

Baserat på dess hämmande effekt på RNA-polymeras är TAS106 känt för att reglera expressionen av dess målproteiner på transkriptionell nivå (Maehara et al, 1982; Hattori et al, 1996; Matsuda och Sasaki, 2004). I denna studie undersökte vi effekten av TAS106 på mRNA-uttrycket av HIF-1a med användning av semikvantitativ RT – PCR. Såsom visas i figur 5A ökade hypoxisk exponering under 36 timmar mRNA-uttrycket av HIF-la med måttligt; emellertid inhiberade TAS106-behandling med eller utan X-bestrålning uppenbarligen mRNA-uttrycket av HIF-la .

TAS106 undertryckte HIF-1 a- uttrycket genom dess hämmande effekt på RNA-syntes i MKN45-celler. ( A ) MKN45-celler behandlade med 20 Gy X-bestrålning och / eller 0, 1 μM TAS106 inkuberades under 36 timmar under antingen normoxi eller hypoxi, varefter total mRNA isolerades och uttrycket av HIF-la mRNA analyserades med användning av RT- PCR. ( B ) Efter förbehandling med antingen 0, 1 μM TAS106, 25 ng ml −1 aktinomycin D eller 10 μg ml −1 cykloheximid under 1 tim, exponerades MKN45-celler för hypoxi eller 100 μM CoCl2 under 12 timmar i närvaro av varje läkemedel. Celllysat bereddes och underkastades immunblotanalys för att undersöka HIF-1 a- proteinuttryck.

Bild i full storlek

Dessutom jämförde vi effekterna av TAS106, actinomycin D som en hämmare av transkription och cykloheximid som en proteinsyntesinhibitor på uttrycket av hypoxia- eller CoCl2-inducerad HIF-1a. Efter att MKN45-celler exponerades för hypoxia eller CoCl2 i närvaro av dessa medel under 12 timmar användes celllysat från tumörceller för immunblotanalys. Som visas i figur 5B hade 0, 1 μM TAS106 och 25 ng ml −1 aktinomycin D måttliga hämmande aktiviteter mot HIF-1 α- uttrycket inducerat av både hypoxi och CoCl2, medan 10 μg ml −1 cykloheximid hämmade uttrycket av HIF -1 a- protein helt. Liknande resultat erhölls från ett experiment på HIF-1 a- överuttryck med användning av proteashämmare, såsom ALLN och MG132 (data visas inte).

Apoptotisk induktion med HIF-1 a antisense oligonukleotidbehandling i MKN45-celler under hypoxi

För att bekräfta HIF-1 a- proteinets roll i den apoptotiska induktionen av MKN45-celler under hypoxi, försökte vi HIF-1 a- reduktivt tillvägagångssätt med hjälp av dess specifika antisense-ODN. Först för att bestämma om behandling med antisense HIF-1 a ODN (AS-HIF-1 a -ODN) undertryckte uttrycket av HIF-1 a , transfekterades MKN45-celler med AS-HIF-1 a -ODN under 24 timmar, följt av inkubation under 4 timmar under hypoxi. Figur 6A visar att hypoxiainducerad HIF-1 a- uttryck helt avskaffades med AS-HIF-1 a -ODN. Transfektionseffektivitet bestämd med användning av FITC-märkta oligonukleotider var ungefär 40–50% vid 24 timmar efter transfektion för varje ODN.

Effekter av hypoxi och X-bestrålning på apoptotisk induktion i MKN45-celler behandlade med en antisense HIF-1 a- oligodeoxynukleotid. ( A ) Hypoxia-inducerad HIF-1 a- uttryck dämpades av en antisense HIF-1 a- oligodeoxynukleotid. Semikonfluent MKN45-celler transfekterades med en förvrängd oligodeoxynukleotid (Srb-ODN; S) eller antisense HIF-1a oligodeoxynukleotid (AS-HIF-1 a -ODN; AS) under 24 timmar, följt av exponering för hypoxi under 3 timmar. För att undersöka transfektionseffektiviteten för Srb-ODN och AS-HIF-1 a -ODN transfekterades FITC-märkta oligodeoxynukleotider som ovan och procentandelen FITC-positiva celler mättes med fluorescensmikroskopi. ( B ) Fluorescensmikroskopisk observation av morfologiska förändringar i kärnor i celler behandlade med Srb-ODN enbart, Srb-ODN och X-bestrålning, AS-HIF-1 a -ODN ensam eller AS-HIF-1 a -ODN och X-bestrålning . ( C ) Apoptotisk induktion i MKN45-celler under hypoxi behandlad med AS-HIF-1 a -ODN och X-bestrålning. Efter transfektion med Srb-ODN eller AS-HIF-1 a -ODN följt av X-bestrålning inkuberades MKN45-celler under hypoxi under 48 timmar. Apoptotiska celler (%) mättes med fluorescensmikroskopi av celler färgade med propidiumjodid. Data uttrycks som medelvärde ± se för tre experiment. ** P <0, 01 vs kontroll.

Bild i full storlek

Därefter undersökte vi om reduktionen av HIF-1 a påverkade apoptotiska celldöd av hypoxiska celler. MKN45-celler behandlades med antingen Srb-ODN eller AS-HIF-1 a -ODN och odlades sedan under hypoxi under ytterligare 48 timmar. Figur 6B visar fluorescensmikroskopisk observation av de morfologiska förändringarna i kärnor, inklusive DNA-fragmentering och kromatinkondensation. Kvantitativa mätningar av apoptotisk induktion avslöjade att transfektionen av Srb-ODN inte ökade andelen apoptotiska MKN45-celler (2, 4 ± 0, 1%) jämfört med den hånstransfekterade kontrollen (2, 2 ± 0, 4%; figur 6C), medan transfektionen av AS-HIF-1 a -ODN ledde till en signifikant ökning av induktionen av apoptotiska celler (23, 8 ± 3, 7%). Dessutom inducerade kombinerad behandling med AS-HIF-1 a -ODN-transfektion och X-bestrålning en markant ökning av apoptos (42, 6 ± 2, 7%). Dessa resultat bevisade att HIF-1 a skyddade MKN45-celler mot hypoxiainducerad apoptos och att reduktionen av HIF- 1a resulterade i förbättrad induktion av röntgeninducerad apoptos i hypoxiska celler.

Minskning av det hypoxiska området genom kombinerad behandling med X-bestrålning och TAS106 i MKN45 xenograft

I en tidigare rapport (Yasui et al., 2007) undersökte vi in vivo- antitumöreffekten av X-bestrålning i kombination med TAS106-administration mot två typer av transplanterade tumörer (murina Colon26 och humana MKN45-tumörer). När 2 Gy X-bestrålning och låga doser av TAS106 (0, 1 och 0, 5 mg kg −1 för tumörer av kolon26 respektive MKN45) kombinerades, observerades signifikant hämning av tumörtillväxt i båda typerna av tumörer jämfört med möss behandlade med X- bestrålning och TAS106 ensam. I denna studie undersökte vi först tillväxtförseningarna för MKN45 xenografts som behandlats med 2 Gy X-bestrålning och / eller 0, 5 mg kg −1 TAS106. Den tid det tog för tumörvolym att nå 700 mm 3 från 350 mm 3 var 8, 8 ± 0, 9 dagar i kontrollgruppen (figur 7A). Med 2 Gy X-bestrålning och 0, 5 mg kg -1 TAS106 försenades tiden 3, 2 respektive 2, 0 dagar, medan deras kombination försenade den 8, 0 dagar. För att undersöka effekterna av X-bestrålning och / eller TAS106-behandling på tumörhypoxi bedömdes förändringarna i omfattningen av de hypoxiska områdena i MKN45 xenografts genom immunhistokemisk analys av den hypoxiska markören pimonidazol. Såsom visas i figur 7A observerades uppenbar reduktion av de hypoxiska områdena, det vill säga de pimonidazol-positiva regionerna i tumörer behandlade med kombinationen av X-bestrålning och TAS106. Andelarna av de hypoxiska områdena till hela tumörregionerna värderades som 14, 2 ± 1, 7% (kontroll), 15, 4 ± 0, 8% (X-bestrålning ensam) och 12, 7 ± 1, 3% (TAS106 ensam), vilket indikerar att en enda behandling med TAS106 minskade tumörhypoxiskt område måttligt men inte signifikant ( P > 0, 05; figur 7B). När det gäller kombinationen av X-bestrålning och TAS106 minskade emellertid andelen av det hypoxiska området signifikant till 9, 1 ± 1, 1% jämfört med kontrollen eller X-bestrålningen enbart ( P <0, 05). Detta resultat antydde att den kombinerade behandlingen med X-bestrålning och TAS106 minskade det hypoxiska området avsevärt.

Effekter av kombinationen av TAS106 (0, 5 mg kg −1 ) och X-bestrålning (2 Gy) på tumörhypoxi i MKN45 xenografts. När tumören nådde en storlek av 350 mm3, behandlades möss med TAS106-administration och / eller X-bestrålning. Storleken på behandlade tumörer övervakades varje dag och tumörer skars sedan i följd från möss när deras storlekar nådde 700 mm3 . ( A ) Typiska fotografier av MKN45-xenotransplantat immunfärgade för pimonidazol. The number of days noted in each photograph shows the time required for tumour growth from 350 to 700 mm 3 . ( B ) The proportions of hypoxic areas in the whole tumours obtained by Scion Image software. Data are expressed as mean±se for three different tumours. ns: P >0.05 vs control. * P <0.05 vs control. †† P <0.01 X-irradiated group vs combination group.

Bild i full storlek

Suppression of HIF-1 α expression by TAS106 treatment in vivo

To examine the effect of TAS106 on the expression of HIF-1 α protein in vivo , we performed immunohistochemical analysis of HIF-1 α (Figure 8A). Quantitative data showed that X-irradiation (2 Gy) alone had little effect on HIF-1 α expression (40.0±2.4%) compared with the control (38.1±4.1%), but it was significantly suppressed to 15.2±1.3 and 15.1±2.6% in the tumours treated with TAS106 alone and the combination of X-irradiation and TAS106, respectively (Figure 8B). These results paralleled those shown in Figure 4C, suggesting that TAS106 also inhibited HIF-1 α expression in MKN45 cells in vivo .

Suppression of HIF-1 α expression by TAS106 treatment in MKN45 xenograft. Tumours were excised at 2 days after X-irradiation and/or TAS106 administration. ( A ) Typical microscopic fields of MKN45 xenografts immunostained for HIF-1 α . ( B ) Quantitative data obtained by immunohistochemical analysis. Data are expressed as mean±se for three different tumours. ** P <0.01 vs control.

Bild i full storlek

Induction of apoptosis in hypoxic area by combined treatment with X-irradiation and TAS106 in MKN45 xenograft

To investigate whether the combination of X-irradiation and TAS106 induced apoptosis in the hypoxic area, we conducted double-immunofluorescent staining for pimonidazole and cleaved casapse-3 using frozen tumour tissues excised 2 days after X-irradiation and/or TAS106 administration. Apoptotic cells were also observed in the DAPI-negative area corresponding to the necrotic region (Figure 9). In the control group and treatment group with either X-irradiation or TAS106 alone, few apoptotic cells were observed, among the pimonidazole-binding hypoxic cells. However, when tumours were treated with X-irradiation and TAS106, an obvious increase of apoptotic cells was detected in the hypoxic area.

Induction of apoptosis in hypoxic cells of MKN45 xenografts by the combination of TAS106 (0.5 mg kg −1 ) and X-irradiation (2 Gy). Tumours were excised at 2 days after X-irradiation and/or TAS106 administration. Pimonidazole-positive cells (green) and cleaved caspase-3-positive cells (red) correspond to hypoxic cells and apoptotic cells, respectively. Tumour cells were also counterstained with DAPI (blue). Cleaved caspase-3-positive cells among normoxic cells (arrow head) and hypoxic cells (merged yellow, arrow) are observed in the MKN45 xenograft treated with X-irradiation and TAS106.

Bild i full storlek

Diskussion

We have previously shown that a wide-range inhibitor of RNA synthesis, TAS106, enhances X-ray-induced cell death regardless of the difference in TP53 status in vitro and in vivo (Inanami et al, 2004). The downregulation of X-ray-induced expression of survivin, a key molecule related to tumour survival and abrogation of the G 2 /M checkpoint because of the attenuation of CDC2-cyclin B1 kinase activity by TAS106 are responsible for this combined effect. Furthermore, we also demonstrated that low doses of TAS106 could potentiate the antitumour efficacy of X-irradiation with 2 Gy in both murine colon26 and human MKN45-transplanted tumours (Yasui et al, 2007). In particular, it was remarkable that repetitive treatments with the combination of X-irradiation and TAS106 induced tumour remission in half of the mice. On the basis of the biological activities of TAS106 and the tumour remission caused by the repetitive treatments, it is possible to assume that TAS106 also radiosensitises hypoxic cells in tumours.

Hypoxia is a common phenomenon in solid tumours because impaired vascular function results in an inadequate blood supply. As there is less X-ray-induced DNA damage in the absence of oxygen, hypoxic cells are resistant to killing by ionising radiation (Brown and Wilson, 2004). In addition, though severe or prolonged hypoxia initiates apoptosis, some cells adapt to hypoxia, survive and gain a more aggressive phenotype (Greijer and van der Wall, 2004). These tumour cells have reduced sensitivity to apoptosis and become more resistant to radiotherapy and chemotherapy. Therefore, it is of interest to investigate whether TAS106 enhances the radiation-induced apoptosis in hypoxic cells as well as in normoxic cells.

In the present in vitro studies, TAS106 enhanced radiation-induced apoptosis under normoxia and hypoxia in a TP53-independent manner, although the induction rate of apoptosis under hypoxia was smaller than that under normoxia (Figure 1B). As shown in Figure 1C, TAS106 abrogated the X-ray-induced G 2 /M checkpoint and increased the number of cells in the sub-G 1 fraction under hypoxia in a fashion similar to that under normoxia. Furthermore, the combination of X-irradiation and TAS106 induced the activation of casapse-3 under both conditions, suggesting a TAS106-stimulated caspase-pathway leading to apoptosis (Figure 1D). This result supported our recent finding that the radiosensitisation of TAS106 was cancelled by the caspase inhibitor Z-VAD-fmk (Inanami et al, 2004). In addition, the present experiment using UCK2 knockdown by siRNA showed that the expression of UCK2 gene in tumour cells was responsible for the enhancement of radiation-induced apoptosis (Figure 2B). This result supported the previous report that a 3′-ethynyl-nucleoside-resistant cell line established from human fibrosarcoma HT-1080 had a deletion of exon 4 of UCK2 mRNA, resulting in a decrease of UCK2 expression (Murata et al, 2004). Interestingly, the induction of apoptosis by the combined treatment with X-irradiation and TAS106 was also observed in hypoxic cells in MKN45 xenografts, as shown in Figure 9. In addition to apoptosis induction, Iizuka et al demonstrated that TAS106 enhanced the loss of clonogenic ability by converting X-ray-induced proapoptotic cells into apoptotic cells in Chinese hamster V79 cells (Iizuka et al, 2005). When we examined the effect of TAS106 on clonogenic survival in MKN45 and MKN28 cells, TAS106 enhanced radiation-induced reproductive cell death not only normoxic condition but also hypoxic condition (Figure 3). These findings in vitro and in vivo strongly suggested that TAS106 could have potent activity to enhance the radiation-induced cell death of hypoxic cells.

For the application of TAS106 for clinical use, it is important to clarify the molecular mechanisms by which TAS106 could enhance the apoptotic induction of tumour cells with X-irradiation. As TAS106 is an inhibitor of RNA synthesis (Matsuda and Sasaki, 2004), we hypothesised that the expression of various apoptosis-related proteins would be non-specifically suppressed by TAS106. In this study, we tested the effect of TAS106 on the expression of anti- and proapoptotic proteins, such as IAPs and Bcl-2 family, in MKN45 cells under normoxia or hypoxia. As expected, the expressions of survivin and cIAP2 were effectively suppressed by the treatment of TAS106 under normoxia (Figure 4B). With respect to the role of survivin in resistance against radiation-induced apoptosis in tumour cells under normoxia, the overexpression of dominant-negative mutants of survivin (T34A and D53A) was demonstrated to enhance radiation-induced apoptosis in mouse fibroblast cell line NIH3T3, human cervical carcinoma cell line HeLa and human lung carcinoma cell line A549 (Ogura et al, 2008). The downregulation of both survivin mRNA and protein expression by TAS106 led to the enhancement of X-ray-induced apoptosis and overexpression of wild-type survivin in MKN45 cells inhibited this apoptotic induction (Inanami et al, 2004). These results indicated that survivin played an important role in the radioresistance of tumour cells under normoxia. Interestingly, it has been shown that the resistance of hypoxic cells to apoptosis is modulated through the upregulation of IAPs, including survivin and cIAP2, induced by hypoxia (Semenza, 2003). In this study, the expression of survivin and cIAP2 was increased in MKN45 cells under hypoxia for 24 h (Figure 4A), suggesting that this upregulation provided MKN45 cells with the resistance to apoptosis observed in Figure 1B and 1C. As shown in Figure 4B, TAS106 reduced the expression of survivin and cIAP2 upregulated by hypoxic exposure, indicating that the downregulation of these antiapoptotic proteins by TAS106 also contributed to the enhancement of radiation-induced apoptosis of hypoxic cells as well as normoxia. Furthermore, we examined whether TAS106 modulated the Bcl-2 family, which is the major regulator of caspase activation. The Upregulation of Bax and downregulation of Bcl-2 favour the proapoptotic response over the antiapoptotic one in tumour cells, leading to the release of cytochrome c and promotion of cell death (Cory and Adams, 2002). In this study, TAS106 treatment reduced the expression of both antiapoptotic Bcl-2 and proapoptotic Bax proteins under both normoxia and hypoxia (data not shown). Thus, TAS106 could not increase the Bax/Bcl-2 ratio in MKN45 cells, suggesting that it might not make the proapoptotic response dominant over the antiapoptotic one.

It is noteworthy that immunoblot analysis and immunohistochemical analysis revealed that TAS106 treatment suppressed the expression of HIF-1 α proteins in vitro and in vivo (Figures 4C and 8). Concerning the mechanism of the HIF-1 α suppression by TAS106, semiquantitative RT–PCR showed that TAS106 inhibited the mRNA expression of HIF-1 α in MKN45 cells under hypoxia (Figure 5A). In addition, the pattern of inhibition of HIF-1 α protein by TAS106 was similar to that of actinomycin D, a transcription inhibitor. These results suggested that TAS106 downregulated HIF-1 α expression transcriptionally as well as actinomycin D. In addition, treatment with cycloheximide, a protein synthesis inhibitor, also inhibits hypoxia-induced HIF-1 α expression. The adaptational response of tumour cells against hypoxia is thought to be mainly mediated by HIF-1 α , which transactivates a number of target genes leading to metabolic adaptation, angiogenesis, invasion/metastasis and apoptosis resistance (Semenza, 2003). Recent studies reported that interfering treatments targeting HIF-1 α, such as antisense or siRNA, induced apoptosis of human tongue squamous carcinoma cells in vitro (Zhang et al, 2004a) and inhibited tumour growth in human cervical and colon adenocarcinoma cells in vivo (Zhang et al, 2004b). In this experiment, we demonstrated that the reduction of the constitutive level of HIF-1 α by an antisense HIF-1 α oligonucleotide markedly increased the number of apoptotic cells (Figure 6C). Zhang et al (2004a) demonstrated that the abrogation of both basal and hypoxia-induced HIF-1 α protein levels induced apoptosis under not only hypoxia but also normoxia in squamous carcinoma cells with constitutive HIF-1 α expression. Combined with their result, our findings suggest that maintaining a constitutive level of HIF-1 α is essential to cell survival. Interestingly, we demonstrated that X-irradiation enhanced HIF-1 α reduction-induced apoptosis (Figure 6C). These data paralleled the synergistic effect of TAS106 on X-ray-induced apoptosis as shown in Figure 1B, suggesting that TAS106 radiosensitised cells to apoptotic induction through the suppression of HIF-1 α expression. Recent reports have shown that survivin gene expression might be regulated by hypoxia and subsequent activation of HIF-1 α (Dong et al, 2003; Greijer and van der Wall, 2004; Peng et al, 2006; Kilic et al, 2007). In this experiment, survivin expression increased under hypoxia for 24 h, suggesting a linkage to hypoxia-induced HIF-1 α expression. Therefore, it is possible that the apoptotic resistance of hypoxic cells was abrogated through the inhibition of HIF-1 α -induced antiapoptotic molecules by TAS106. Further information is necessary to clarify the mechanism by which TAS106 overcomes the resistance of hypoxic cells to X-ray-induced apoptosis.

In conclusion, we demonstrated that TAS106 could radiosensitise apoptotic induction in not only normoxic but also hypoxic cells in vitro and in vivo , which might be mainly related to the inhibition of HIF-1 α expression. Importantly, TAS106 significantly reduced the hypoxic regions of X-irradiated MKN45 xenografts, probably because of this apoptotic induction. To overcome the radioresistance of apoptosis in hypoxic cells of solid tumours, the use of radiation sensitisers against not only normoxic cells but also hypoxic cells is necessary in combination with radiotherapy. On the basis of our results, the novel anticancer drug TAS106, which was effective for hypoxic cells through HIF-1 α inhibition is a candidate sensitiser for radiotherapy.

Förändra historien