Konstruera campylobacter jejuni n-glycan för att skapa ett effektivt kycklingvaccin | vetenskapliga rapporter

Konstruera campylobacter jejuni n-glycan för att skapa ett effektivt kycklingvaccin | vetenskapliga rapporter

Anonim

ämnen

  • Konjugatvacciner
  • microbiome
  • patogener

Abstrakt

Campylobacter jejuni är en dominerande orsak till mänsklig gastroenterit över hela världen. Källtillskrivningsstudier indikerar att kycklingar är den viktigaste behållaren för infektion, och eliminering av C. jejuni från fjäderfä skulle betydligt minska bördan på människors sjukdom. Vi konstruerade glykokonjugatvacciner som kombinerade den konserverade C. jejuni N-glykanen med en proteinbärare, GlycoTag, eller smält till Escherichia coli lipopolysackaridkärnan. Vaccination av kycklingar med den proteinbaserade eller E. coli- visade glykokonjugatet visade upp till 10-log reduktion i C. jejuni- kolonisering och inducerade N-glykanspecifika IgY-svar. Dessutom rensades det levande E. coli- vaccinet före C. jejuni- utmaningen och inget val för resistenta campylobacter-varianter observerades. Analyser av kycklingarmsamhällen avslöjade att det levande vaccinet inte förändrade mikrobiomets sammansättning eller komplexitet, vilket således representerade en effektiv och lågkostnadsstrategi för att minska C. jejuni i kycklingar och dess senare inträde i livsmedelskedjan.

Introduktion

Campylobacter- infektioner (främst C. jejuni eller C. coli ) är bland de vanligaste orsakerna till mänsklig gastroenterit världen över 1, 2 . Eftersom C. jejuni är en vanlig medlem i kycklingstarmmikrobiomet, är fjäderfä viktigaste källor för mänsklig infektion som resulterar i utveckling av vattnig diarré, hemorragisk kolit och i vissa fall reaktiv artrit, Reiters syndrom, irriterande tarmsyndrom och Guillain-Barré syndrom 3, 4 . Således skulle minskning av C. jejuni vid källan avsevärt minska risken för människors exponering och ha en enorm inverkan på livsmedelssäkerhet och folkhälsa.

Viktiga förutsättningar för att antigener kan betraktas som vaccinkandidater är immunogenicitet och ytutsättning. Dämpade campylobacter-helcellsvaccin och nanopartikel inkapslade råmembranproteinlysater har testats, men visade begränsat skydd 5, 6 . Mer rationella metoder inkluderade användningen av specifika proteinantigener antingen renade, DNA-baserade eller levererade av dämpade Salmonella-stammar. Dessa inkluderar flagellinsubenheten FlaA 7, 8, det yttre membranproteinet MOMP 9, vidhäftningen Pebl 10, flödesmedicinsk efflux-pumpkomponent CmeC 11, ferr-enterobactinreceptorn CfrA, lipoproteinerna CjaA och CjaC (medierande aminosyratransport) 12, bland andra 13, 14, 15, 16, 17, 18, 19 . Även om målspecifika antikroppssvar inducerades i de flesta fall gav svaret antingen begränsat skydd (FlaA-LTB 20 ; rCmeC 21 ; CjaD 22 Dps 23 ), var riktad mot konformationellt variabla epitoper (MOMP) 24, 25, var inte tvär- skyddande (FlaA) 26, 27 eller resultaten var mycket varierande (CjaA eller CjaA-TetC) 22, 28, 29, 30, 31 beroende på modellsystemet eller administreringsvägen. På senare tid antyddes äggula som producerade a-CadF, a-MOMP och α-CmeC IgYs som potentiellt användbara som passiva immunterapeutika 32, men deras tillämpning resulterade inte i en minskning av campylobacter-kolonisering hos kycklingar 33 .

Kolhydrater representerar en annan klass av biomolekyler som framgångsrikt har använts för alstring av humana glykokonjugatvacciner, men som för närvarande inte är kommersiellt tillgängliga för djur 34 . C. jejuni är rik på ytkolhydrater inklusive O- och N-bundna glykoproteiner 35, 36, kapselpolysackarider (CPS) och lipooligosackarider (LOS); och studier som använde campylobacter CPS-strukturer som antigener visar löfte i vaccinförsök för mänskligt bruk 37, 38, 39 . Men eftersom 47 olika CPS-serotyper hittills har identifierats för C. jejuni , behöver antalet CPS-typer som behövs för att uppnå en bred täckning mot de vanligaste stammarna av C. jejuni bestämmas och övervakas för att växla populationer 37 . På liknande sätt begränsar variationen i LOS- och O-glykanstrukturer användningen av dessa kolhydrater som potentiella antigener. Vi var därför intresserade av att utvärdera användningen av C. jejuni N-glykan som en vaccinkandidat i kycklingar. C. jejuni N-glycan är en heptasackarid (GalNAc-a1, 4-GalNAc-a1, 4- [Glc-p-1, 3] GalNAc-a1, 4-GalNAc-a1, 4-GalNAc-a1, 3- diNAcBac; diNAcBac är 2, 4-diacetamido-2, 4, 6-trideoxy-D-glukopyranos, GalNAc är N-acetylgalaktosamin och Glc är glukos) 40, 41 som är gemensamt för alla C. jejuni och C. coli isolat testade 35, 36 N-glykanen uttrycks konstitutivt, läggs till flera periplasmatiska och membranproteiner, skyddar bakterierna mot proteolytisk attack, är immunogen hos kaniner och människor, spelar en roll i medfödd och adaptiv immunitet och krävs för kolonisering av möss och kycklingar, vidhäftning och invasion av mänskliga epitelceller och naturlig kompetens 35, 42, 43, 44 . Dessutom kan C. jejuni- proteinglykosyleringsgenerna ( pgl ) gener överföras till heterologa värdar som E. coli 40 för att producera glykoproteiner för biotekniska tillämpningar 44 .

Här presenterar vi två vaccinstrategier. För den första metoden skapade vi ett glykoprotein som består av en naturlig förekommande C. jejuni- peptid (GlycoTag, GT) som innehåller 9 perfekta upprepningar av den bakteriella N-glykosyleringssekvensen (D / E-X1-N-X2-S / T, där X1 och X2 kan vara vilken aminosyra som helst men prolin 45 ) och lätt modifieras med upp till 9 C. jejuni N-glykaner när GlyoTag är smält till ToxC. I det andra tillvägagångssättet användes ett helt cellytningsvisningssystem för att smälta N-glykanstrukturen till den yttre kärnan av E. coli lipopolysaccharide (LPS), vilket ersatte det naturliga O-antigenet. Fåglar som var vaccinerade med de GlycoTag-baserade eller E. coli -cellytan exponerade N-glykanerna visade N-glykanspecifika immunsvar och signifikanta reduktioner i C. jejuni- koloniseringsnivåer efter campylobacter-utmaning. Levande vaccin mot E. coli var självbegränsande och påverkade inte sammansättningen av kycklingarmssamhället och gav därmed en billig och effektiv vaccinationsstrategi för att minska C. jejuni hos fjäderfä.

Resultat

Uttryck av det proteinbaserade C. jejuni N-glykanvaccinet

För att skapa ett effektivt proteinglykokonjugat för syntesen av en-potten av N-glykoproteiner in vivo identifierade vi en ny campylobacter-härledd N-glykanacceptorpeptid, GlycoTag, belägen i N-terminalen av Cj1433. GlycoTag innehåller 9 perfekta upprepningar av aminosyrasekvensen KIDLNNT inklusive den bakteriella N-glykosyleringsacceptorsekvensen DLNNT för bindning av flera C. jejuni N-glykaner när de uttrycks i E. coli (fig. 1A). Vi genetiskt smälte GlycoTag till C-terminalen i en avkortad och inaktiv variant av C. difteritoxinet , ToxC och satte vidare in en hexa-hans kodningssekvens till C-terminalen och en pelB- utsöndringssignal till N-terminalen i konstruera (fig. 1B, C). GlycoTag-fusionen uttrycktes i E. coli i närvaro av C. jejuni- proteinglykosylering ( pgl ) -operon och renades till homogenitet (fig. 1D, panelerna a och b). Western blot-analys bekräftade modifiering av GlycoTag-fusionsproteinet med upp till 9 C. jejuni N-glykaner (fig. 1D, panel b och c). Kolhydratinnehållet, baserat på fenol-svavelsyraanalysen, beräknades vara i genomsnitt 3-4 N-glykaner per molekyl protein som motsvarade ungefär 150 ug N-glykan per mg ToxC-GT-His 6 .

(A) De första 150 aminosyrorna av C. jejuni Cj1433c-polypeptiden visas. Sekvensen som innehåller GlycoTag-peptiden (nio upprepningar av [KIDLNNT]) är belägen mellan de dubbla asteriskerna (**). Den bakteriella N-glykosyleringssekvensen (DLNNT) betonas. (B) Schematiskt diagram över ToxC-GlycoTag-His 6- expressionskonstruktionen: pT7, IPTG-inducerbar promotor; pelB , pET22b-härledd pektat lyas B-ledarsekvens; toxC , trunkerad, icke-toxisk variant av C. difteritoxinet ; Hans 6, hexa-histidin-tagg. (C) Det förväntade N-kopplade glykosylerade fusionsproteinet visas. ( D) Expression och rening av glykosylerad ToxC-GlycoTag-His 6 i närvaro av pACYC184 ( pgl ) i E. coli BL21 (DE3). (a) En 12, 5% SDS-PAGE av hela celllysat av BL21 / ToxC-GlycoTag-His 6 (L) och kombinerade elueringsfraktioner efter IMAC (E). Western blottar med R1-4 antiserum av (a) kombinerade elueringsfraktioner efter IMAC, efter (b) anjonbyteskromatografi och (c) efter storleksuteslutningskromatografi. Molekylviktsmarkörer (i kDa) visas till vänster.

Bild i full storlek

Expression och validering av hela cellen E. coli - C. jejuni N-glykanvaccin

För att presentera C. jejuni N-glycan på E. coli- cellytan smälte vi heptasackariden till den yttre LPS-kärnan i en E. coli K12 O-antigenpolymeras ( wzy :: kan ) mutantbakgrund för att undvika potentiell polymerisation av N-glykanstrukturen (fig. 2A). E. coli K12 producerar inte endogent O-antigen (O16) på grund av en naturligt förekommande mutation i wbbL (rhamnosyltransferas) genen 46 . Western blotting med C. jejuni N-glykanspecifikt antiserum (R1-4) bekräftade bildningen av LPS-kärn-N-glykansfusion genom produktion av en immunreaktiv signal närvarande i proteinas K-behandlat E. coli wzy :: kan pACYC184 ( pgl mut ) celler som migrerade runt 15 kDa (fig. 2B, spår 1). Denna signal var frånvarande i proteinas K-behandlade celler i den tomma vektorkontrollen, E. coli wzy :: kan pACYC184 (fig. 2B, spår 2). FACS-analys av 2 x 104 formalinfixerade celler testade med R1-4 och fluorescerande märkta (Alexa546) sekundär antikropp visade en signifikant ökning i fluorescens för E. coli wzy :: kan (pACYC184 ( pgl mut ) celler jämfört med E. coli wzy :: kan (pACYC184) (fig. 2C). Topputseendet och geometri innebär närvaron av en jämförbar mängd av C. jejuni N-glykan på varje E. coli- cell.

(A) Tecknad film som visar O-antigenligas (WaaL) -beroende tillsats av N-glykanstrukturen till LPS-kärnan i E. coli . (B) Western blot av proteinas K digererade hela celllysat av E. coli wzy :: kan (pACYC184 ( pgl mut )), spår 1 och E. coli wzy :: kan (pACYC184), spår 2 testade med R1-4 är visad. Bildningen av LPS-kärn-N-glykanmolekylen indikeras med en pil. Molekylviktsmarkörer (i kDa) visas till vänster. (C) FACS-analys av 2 × 10 * 4 celler av E. coli wzy :: kan (pACYC184 ( pgl mut )) i ljusgrå och E. coli wzy :: kan (pACYC184) i mörkgrå. Fluorescerande intensitet visas på x-axeln, cellräkningar (godtyckliga enheter) visas på y-axeln. (D) Sekvensen för LPS-kärnans N-glykans fusionsprodukt visas. N-glykan-härledda monosackaridrester visas med rött. För LPS-kärndelen visas endast kolhydratrester som kan tilldelas av NMR. Med stora bokstäver hänvisas till rester som beskrivs i tilläggstabell 2. (E) NMR-spektrum för den renade LPS-kärnan- C. jejuni- N-glykanförening. Korrelationer från anomera protoner (som indikerat) visas. Grön, COZY; röd, TOCSY; svart, ROESY.

Bild i full storlek

Den renade hybridmolekylen analyserades vidare genom NMR som bekräftade att en enda enhet av C. jejuni N-glykan fusionerades till E. coli LPS-kärnan. Tilldelningar för N-glykanen och E. coli LPS-kärndelen var i god överensstämmelse med publicerade data 35, 47 (fig. 2D, E, kompletterande tabell 2): ​​alla 1–4- kopplingar till C. jejuni N- glykankomponenter gav transglykosidiska kärnkraftseffekter av 1: 4 och 1: 6, alla signaler från den yttre LPS-kärnan l- glycero- d- manno- heptos (Hep, L i tabell S2) hittades genom analys av huvudhögen av korrelationer och N-glykanen var kopplad till O-7 för Hep (fig. 2D). I stället för diNAcBac som utgör det infödda C. jejuni N-glykans reducerande slutsockret, hittades GlcNAc vid denna position som tidigare har observerats vid uttryck av C. jejuni N-glykanstrukturen i E. coli 48 .

N-glykanbaserade vacciner minskar C. jejuni- kolonisering hos kycklingar

I en 35-dagars SPF Leghorn kycklingutmaningsmodell testade vi effekten av varje vaccinsammansättning såväl som den bästa doseringen och administreringsvägen. Glykoproteinvaccinerna injicerades i bröstet eller i benet medan hela cellvacciner (levande eller inaktiverade) gavs oralt. Först bestämde vi C. jejuni- utmaningen och proteinglykokonjugatdoserna (Fig. 3A). Fåglar som utmanades med 1 x 10 * 2 och 1 × 10 * 6 C. jejuni- celler på dag 28 visade jämförbara koloniseringsnivåer. Vaccination i bröstet dag 7 och 21 med 5 μg eller 100 μg renat glykosylerat ToxC-GT-protein resulterade i en statistiskt signifikant minskning av bakteriekolonisering (p-värden <0, 05 respektive <0, 005) efter utmaning med 1 × 10 * 2 C. jejuni . I behandlingsgrupperna som fick en högre C. jejuni- utmaningsdos (1 × 10 * 6) minskades bakterielastningen signifikant hos fåglar som fick den högre vaccindosen (p-värde> 0, 05). Fåglar som fick den lägre vaccindosen visade ingen statistisk signifikant skillnad jämfört med den icke-vaccinerade gruppen (p-värde> 0, 05). På liknande sätt ledde vaccination med icke-glykosylerad ToxC-GT till liknande koloniseringsnivåer jämfört med den positiva kontrollgruppen (Fig. 3A). Ingen C. jejuni över detektionsgränsen på 1 × 10 * 2 CFU / gram cekalt innehåll observerades hos negativa kontrollfåglar. Därefter testade vi om injektionsstället påverkar effekten av proteinvaccinet (Fig. 3B). Koloniseringsnivån efter utmaning med 1 × 10 * 2 C. jejuni sjönk signifikant från 2 × 10 * 10 i de positiva kontrollfåglarna till 2 × 10 * 6 (p-värde <0, 005) och 9 × 10 * 2 (p-värde <0, 005) kolonibildande enheter (CFU) per gram cekalt innehåll i fåglar vaccinerade i bröstet eller i benet på dag 7 och 21. Nivåer av C. jejuni i fåglar med negativ kontroll var under detektionsgränsen. Som jämförelse testade vi också effektiviteten hos inaktiverade E. coli- celler som visade N-glykan som administrerades med oral sondage. För denna behandling observerades ett statistiskt signifikant fall (p-värde <0, 005) i C. jejuni- belastningen efter utmaning till 3 × 10 * 6 CFU per gram cekalt innehåll (Fig. 3B). Därefter testade vi det levande E. coli- vaccinet. I två oberoende studier vaccinerades fåglar oralt med E. coli- stammen som uttrycker LPS-kärn-N-glykan på dess yta. C. jejuni- kolonisering efter utmaning reducerades signifikant (p-värde <0, 005) jämfört med koloniseringsnivåer i ovaccinerade fåglar (Fig. 3C, D). Däremot observerades ingen statistiskt signifikant skillnad (p-värde> 0, 05) i koloniseringsnivåerna hos fåglar som fick den isogena E. coli- stammen som inte uttrycker C. jejuni N-glykanstrukturen på dess yta (fig. 3D).

(A – D) Koloniseringsnivåer för C. jejuni 81–176 visas. Varje datapunkt representerar en enda fågel, grå staplar representerar medianivån för C. jejuni- kolonisering för varje grupp uttryckt som CFU per gram cekalt material (detektionsgräns, 1 × 10 * 2 CFU). Fåglar i de negativa kontrollgrupperna (PBS) var icke-vaccinerade, icke-utmanade; fåglar i de positiva kontrollgrupperna (+ ve) var inte vaccinerade men utmanades med C. jejuni 81–176. (A) Behandlingsgrupper inkluderade fåglar som vaccinerades genom att injicera antingen 100 μg eller 5 μg glykosylerat ToxC-GT-His 6- protein eller icke-glykosylerat ToxC-GT-His 6- protein (kontroll) i bröstet dag 7 och 21 före utmaning med 10 * 2 eller 10 * 6 CFU (som indikerat) av C. jejuni 81–176 på dag 28. ( B ) Behandlingsgrupper inkluderade fåglar som vaccinerades genom att injicera 5 μg glykosylerat ToxC-GT-His 6- protein i bröst eller i benet på dag 7 och 21 och parallellt, fåglar som orsakades oralt med 10 * 8 inaktiverade E. coli- celler som uttrycker C. jejuni N-glycan på ytan före utmaning med 10 * 2 CFU C. jejuni 81–176 på dag 28. (C) . Fåglar i behandlingsgruppen gavs oralt på dag 7 och 21 med 10 * 8 levande E. coli- celler som uttrycker C. jejuni N-glycan på deras yta före utmaning med 10 * 2 CFU av C. jejuni 81–176 på dag 28 (D) Fåglar i behandlingsgrupperna gavs oralt på dag 7 och 21 med antingen 10 * 8 levande E. coli- celler som inte uttrycker N-glycan (kontrollgrupp) eller 10 * 8 levande E. coli- celler som uttrycker C. jejuni N-glykan på ytan före utmaning med 10 * 2 CFU av C. jejuni 81–176 på dag 28. (E) N-glykanspecifika antikroppssvar. ELISA resultat med en 1:10 utspädning av kyckling sera från blödningar tagna före C. jejuni utmaning (dag 28). Varje punkt representerar antikroppssvaret mätt vid OD 405 för varje individuell kyckling. Grå staplar representerar medianen för varje grupp. (A – E) Statistiska skillnader mellan grupper indikeras: n, ingen statistisk signifikant skillnad ( p- värde <0, 05); * och ** indikerar statistiskt signifikanta skillnader med p- värden> 0, 05 respektive> 0, 005.

Bild i full storlek

Vi bestämde också de relativa nivåerna av E. coli i fåglar som fick det levande vaccinet. Inget E. coli detekterades före den första E. coli- sonden (dag 7). Nivåerna av E. coli minskade när de övervakades 2, 5 och 9 dagar efter den första vaccinationen (kompletterande tabell 3 och kompletterande metoder). En snabbare reduktion av E. coli observerades efter den andra sonden (dag 21) utan någon påvisbar E. coli på dag 28 för vaccinstammen och låga nivåer av E. coli hos fåglar som fick kontrollstammen. Ingen E. coli detekterades på dag 35 vilket tydligt visade att vaccinstammen är självbegränsande. Intressant nog tycktes det levande E. coli- vaccinet som uttrycker N-glykanen rensas snabbare jämfört med E. coli- kontrollstammen.

Vaccinerade fåglar utvecklar ett N-glykanspecifikt IgY-svar

N-glykanspecifika immunsvar bestämdes i sera tagna vid dag 28 före C. jejuni- utmaning (Fig. 3E). Det genomsnittliga immunsvaret mot varje vaccin motsvarade graden av skydd mot C. jejuni- kolonisering; de högsta individuella titrarna korrelerade dock inte med fåglar som visade de lägsta nivåerna av C. jejuni- kolonisering. De högsta titrarna med en statistiskt signifikant ökning av IgY-nivåerna jämfört med negativa kontrollfåglar, observerades hos fåglar vaccinerade med den levande E. coli- stammen som uttrycker N-glycan (p-värde <0, 005) på dess yta följt av fåglar som erhöll den inaktiverade stammen (p-värde 0, 1). Även om vissa fåglar som fick proteinglykokonjugaten också uppvisade en ökning av N-glykanspecifika IgY-nivåer jämfört med negativa kontrollfåglar, resulterade jämförelsen av median inte i en total statistiskt signifikant ökning (p-värden> 0, 05). Inga detekterbara N-glykanspecifika antikroppstitrar var närvarande i icke-vaccinerade fåglar, i fåglar som fick E. coli- stammen som inte uttryckte N-glykanen, och i fåglar som fick icke-glykosylerad ToxC-GT-His 6 (ej visat ) vilket indikerar att den observerade ökningen av IgY-titrar berodde på närvaron av C. jejuni N-glycan på antingen ytan av E. coli eller när N-kopplad till ToxC-GT His 6- proteinet.

Vaccination av kycklingar väljs inte för C. jejuni- resistenta stammar

Även om vissa fåglar som vaccinerats med den levande E. coli N-glykan som uttrycker stam visade icke-detekterbara nivåer av C. jejuni- kolonisering, hade andra fortfarande låga nivåer av kolonisering (Fig. 3C, D). De isolerade C. jejuni- kolonierna undersöktes med N-glykanspecifikt R1-4-antiserum (kompletterande figur 1). Varje koloni visade stark reaktivitet med antiserumet som bekräftade att dessa isolat fortfarande uttrycker N-glykan och att inget val för C. jejuni- varianter som saknade N-glykanskonstruktion ägde rum (kompletterande fig 1). Hela celllysat av vildtyp, upptäckt som en positiv kontroll, resulterade i en liknande fläckintensitet när visuellt jämfördes med de N-glykans positiva kolonierna, medan endast bakgrundsreaktivitet observerades när man upptäckte hela celllysat av C. jejuni N-glykosylering mutant ( pglB ) som indikerar att den observerade reaktiviteten verkligen är beroende av närvaron av N-glykan.

Vaccination förhindrar C. jejuni- kolonisering utan förändringar i den bosatta bakteriesamhället i Leghorn kycktarm

Hos fåglar från de positiva kontrollgrupperna som initialt ympades med 1 × 10 2 CFU C. jejuni och därefter visade koloniseringsnivåer upp till 1 × 10 * 10 CFU / gram cekalt innehåll, orsakade närvaron av C. jejuni en förändring i den globala strukturen för de bosatta bakteriesamhällena, såsom visas i en icke-metrisk multidimensionell skalning (NMDS) förordningsplott baserad på Bray Curtis-metrics (Fig. 4A) och PCoA på vägda UniFrac-metrics (data visas inte). Vaccination med det levande E. coli- baserade vaccinet reverserade dessa förändringar, vilket fick tarmmikrobiota hos vaccinerade fåglar att flytta tillbaka till kompositionen som observerades i den negativa kontrollgruppen som inte fick C. jejuni . Bedömning av alfadiversitet (inom prover) visade inga signifikanta skillnader mellan dessa två behandlingsgrupper (Fig. 4B). Inokulation med C. jejuni ledde till stor kolonisering av arten, vilket ledde till en signifikant ökning av det relativa överflödet av mikrober från phylum Proteobacteria (ökade från 12% till 35%), familjen Campylobacteracae (ökade från mindre än 0, 001 till 19% ), släkten Campylobacter (ökade från mindre än 0, 001% till 19%) och arten (OTU) C. jejuni / C. subantarcticus (ökade från mindre än 0, 001% till 22%) (Fig. 4C) som visar att C. jejuni etablerar sig i kycklingarna utan att minska mångfalden eller ändra den bosatta samhället, vilket stöder dess icke-patogena status. Vaccination ledde till en betydande minskning av koloniseringen av C. jejuni (mindre än 0, 001%, p <0, 05), vilket stödde våra kulturbaserade fynd. Få andra signifikanta förändringar i mikrobiota detekterades. En OTU relaterad till Clostridium tertium minskade från 20% i den negativa gruppen, till 11% i den positiva och minskade ytterligare till 6% i den vaccinerade gruppen (p = 0, 0444) (Fig. 4C).

(A) NMDS-ordningsdiagram för cekala bakteriesamhällen baserat på Bray-Curtis avståndsmetris. Kolonisering av C. jejuni (positiv grupp) orsakar en förändring i den globala mikrobiella sammansättningen av Leghorn-tarmen, medan bakteriesamhällsstrukturen hos vaccinerade fåglar liknar den hos fåglar från den negativa kontrollgruppen. (B) Vaccinbehandling orsakar inga förändringar i alfadiversiteten mätt med Simpson-indexet för mångfald. (C) Sammansättning av den cekala bakteriesamhället på filum, familj, släkte och arter (OTU).

Bild i full storlek

Diskussion

Tre huvudsakliga strategier för att minska C. jejuni- infektion hos fjäderfä har identifierats 49 : (1) minskning av miljöexponering (t.ex. biosäkerhetsåtgärder), (2) mätningar för att minska C. jejuni i kycklingarna (t.ex. vaccination) och (3) ) användning av antimikrobiella alternativ (t.ex. bakteriofagterapi eller bakteriocinbehandling). Förutom biosäkerhetsåtgärder är dessa metoder fortfarande under utveckling. Aktiv immunisering av fjäderfä skulle vara ett attraktivt alternativ till administrering av antibiotika för att minska mängden C. jejuni i den ursprungliga värden och den resulterande diarrésjukdomen hos människor.

Ett effektivt vaccin mot C. jejuni hos fjäderfä måste möta tre huvudutmaningar: (1) identifiering av korsskyddande antigener, (2) induktion av ett snabbt och starkt immunsvar, och (3) utveckling av nya adjuvanser till ytterligare stimulera immunitet mot C. jejuni 50 . C. jejuni N-glycan uppfyller alla dessa krav. Den är ytutsatt 35, 42, immunogen hos människor och kaniner 35, 51, 52, och, såsom visas i denna studie, inducerar ett skyddande immunsvar hos kycklingar. Dessutom fungerar lipid A i det levande E. coli- vaccinet såväl som användningen av toxoiden, ToxC, i ToxC-GT- C. jejuni N-glycan-His 6- glykokonjugatet som naturliga hjälpmedel för att stimulera immunsystemet. Eftersom N-glykanen är den enda glykokonjugatstrukturen som bevaras bland alla C. jejuni- isolat 35, 36, 53, skulle vi förvänta oss att den N-glykans specifika immunresponsen skulle vara korsskyddande.

Både vårt rekombinanta glykoprotein (GlycoTag) och hela celltillförselmetoder resulterar i en multivalent presentation av N-glykanen. Multivalent presentation av streptokockkolhydratepitoper i grupp B visades vara betydligt effektivare än för närvarande tillgängliga vacciner som har ett lägre förhållande mellan kolhydrat och protein 54 . På liknande sätt var ett vaccin med två till fem CPS per CRM197 tillräckligt för att inducera ett skyddande immunsvar hos möss och apor mot utmaning med C. jejuni 81–176 39 . Även om vi observerade en minskning av C. jejuni- kolonisering med administrering av högre doser av glykokonjugatvaccinet efter utmaning med 10 * 2 samt 10 * 6 C. jejuni CFU, är den lägre utmaningsdosen förmodligen mer reflekterande av de naturliga förhållandena när C. jejuni introduceras först i flocken, t.ex. genom flugor som kommer in i fjäderfähusen 55, 56 . Konstgjorda flygmatningsstudier visade att C. jejuni- nivåerna inte är högre än 1 × 10 * 4 CFU 57 och det har visats att så låga som 40 kolonidannande enheter av C. jejuni är tillräckliga för att inducera kycklingkolonisering, men den infektiösa dosen varierar mellan stammar av C. jejuni 58, 59 .

Presentationen av N-glykanen på E. coli- cellytan är möjlig på grund av samspelet mellan det endogena O-antigen LPS och de heterologa N-glykans biosyntesvägarna 60, 61, 62 och deras krav på undekaprenylfosfat för sockermontering. Intressant kan WecA, det initierande GlcNAc-transferaset som är involverat i enterobakteriellt gemensamt antigen och O-antigenbiosyntes ersätta C. jejuni PglC-funktion men föredrar UDP-GlcNAc snarare än UDP-diNAcBac som den initierande monosackariden 61 . Även om pglC (på pACYC184 pgl mut ) och den kromosomala kopian av wecA båda finns i den levande vaccinstammen och det har visats att diNAcBac och GlcNAc innehållande C. jejuni N-glycan-lipidbundna oligosackarider (LLO) producerades samtidigt när pgl locus uttrycks i E. coli 48, endast GlcNAc visade sig vara kopplingssockret till O-7 i L- glycero- d- manno- heptosen i LPS-kärnan. En förklaring kan vara att även om E. coli K-12 WaaL O-antigen ligas har rapporterats sakna substratspecificitet 63, föredrages GlcNAc innehållande N-glycan LLO framför diNAcBac innehållande LLO. Man kan hävda att frånvaron av diNAcBac negativt kan påverka det skyddande immunsvaret mot C. jejuni N-glykan, men vi har tidigare visat att immunresponsen mot N-glykanen är riktad mot de icke-reducerande slutresterna 35, 64 65, 66 .

Den levande E. coli- vaccinstammen ger bättre skydd mot C. jejuni jämfört med den inaktiverade E. coli som troligen beror på längre antigenexponeringstider i kycklingen och genom induktion av ett starkare slemhinneimmunsvar från en levande bärare. Det faktum att levande E. coli som uttrycker N-glykanen rensas snabbare efter den andra (booster) dosen jämfört med E. coli enbart kan vara ett resultat av detta N-glykans specifika immunsvar inducerat av denna stam, vilket minimerar risken för köttförorening med vaccinstammen. Det levande E. coli- vaccinet förhindrar C. jejuni- kolonisering utan att förändra den inhemska kycklingmen mikrobiota, vilket antyder ett specifikt immunsvar utan några negativa effekter på mikrobiomsammansättningen.

Vi demonstrerade att N-glykanen fortfarande fanns på alla C. jejuni- isolat efter passage genom vaccinerade fåglar vilket indikerade att det inte fanns något val för N-glykan-negativa C. jejuni- varianter. Detta är inte överraskande eftersom pgl- generna saknar homopolymera kanaler som utsätts för högfrekvent glidsträngsmutation som visas för gener som kodar för C. jejuni O-länkade glykaner, LOS och CPS-strukturer 37, 67, 68, 69, 70, 71 . I det osannolika fallet att selektion mot N-glykan skulle inträffa skulle dessa celler inte kunna överleva i kycklingarna eftersom N-glykan själv krävs för kycklingkolonisering och skyddar cellen från proteolytisk attack av kycklingarmproteaser 35, 42, 43, 44 .

Användningen av den konserverade N-glykanstrukturen i vaccinkompositioner reducerar C. jejuni avsevärt vid källan. Vi visar att behandling med proteinbaserade glykokonjugat signifikant reducerar C. jejuni- kolonisering efter utmaning med organismen oberoende av injektionstidpunkten eller applikationsstället. Oral vaccination med levande E. coli- celler som uttrycker N-glykanen på deras yta reducerade koloniseringen signifikant. De totala nivåerna av IgY-antikroppar överensstämde med skyddsnivån efter utmaning, vilket indikerade att responsen är skyddande.

Användningen av levande E. coli som en självbegränsande bärare för N-glykanantigenet är gynnsam jämfört med tidigare använda Salmonella-baserade leveranssystem som kan visa sig vara svåra att införa med avseende på livsmedelsstandarder i vissa länder. Dessutom är E. coli- vaccinet lätt att tillverka och administrera jämfört med användningen av enskilda proteinantigener som måste renas i stor skala och potentiellt administreras med subkutana injektioner för att nå sin fulla potential. Dessa fakta gör det möjligt att testa vaccinet i storskaliga applikationer med andra populära kycklingraser för att skapa ett billigt vaccin för C. jejuni- reduktion.

metoder

Bakteriestammar, plasmider och tillväxtförhållanden

C. jejuni- stammen 81–176 odlades på Mueller Hinton (MH) -agar (Difco) vid 37 ° C under mikroaeroba förhållanden (85% N2, 10% CO2 och 5% O2). Escherichia coli- stammar odlades på Luria Bertani (LB) eller 2-gånger YT (2xYT) medium kompletterat med ampicillin (Amp), kanamycin (Km) eller kloramfenikol (Cm) i en slutkoncentration av 100, 50 eller 20 μg / ml där det behövs. Karmali-tillägg (om nödvändigt) tillsattes enligt tillverkarens anvisningar (Oxoid). Bakteriestammar och plasmider sammanfattas i tilläggstabell 1.

Bioinformatiska analyser av C. jejuni proteome

FASTA-proteinsekvenser från C. jejuni- arter tillgängliga från EMBL-servern (//www.ebi.ac.uk/) användes för att utföra en aminosyramotivsökning med hjälp av proteinmönstret find software Sequence Manipulation Suite: Protein Pattern Find (// bioinformatics.org/sms2/protein_pattern.html, med (d | e) .n. (s | t) som sökkriterier som matchar kravet för den bakteriella N-länkade glykosyleringsplatsen D / E-X1-N-X2- S / T. Eftersom positionerna X1 och X2 inte tolererar en prolin 45 undersöktes man erhållna sekvenser manuellt med avseende på förekomsten av denna aminosyra och utesluts om de var närvarande. Annoteringarna / förmodade funktionerna för de återstående proteinerna sökades därefter (manuellt) efter nyckelord "periplasmisk", "membran" och "utsöndrade proteiner" och proteiner sorterades efter frekvensen av närvarande glykosyleringsplatser.

Kloning, expression och validering av det glykosylerade GlycoTag-fusionsproteinet

The gene encoding an enzymatically inactive and nontoxic form of the diphtheria toxin (toxoid, toxC ) from Corynebacterium diphtheriae was amplified from plasmid pPDT1 72 with oligonucleotides CS-378 (5′- ATATATATCCATGGCTGCTGATGATGTTGTTGATTC-3′) and CS-379 (5′- ATATACTCGAGTCGCCTGACACGATTTCCTGCACAGG3′) to introduce NcoI and XhoI sites, respectively. The obtained NcoI-XhoI digested PCR product was inserted into plasmid pET22b cut with the same enzymes translationally fusing the gene to the plasmid-derived pelB secretion sequence for the transport of the product into the periplasmic space. A 271 bp DNA fragment including the 9 N-glycosylation sequon repeat (GlycoTag, GT) was amplified from chromosomal DNA of C. jejuni 11168 with oligonucleotides CS-334 (5′ AAACTCGAGTTCATAAAAAATTTCAAGC3′) and CS-335 (5′ ATATCTCGAGCTCTTTTTTTAATTGCG3′) inserting XhoI sites in the 5′ and 3′ prime ends. To fuse the GlycoTag sequence to the C-terminus of ToxC, the XhoI digested PCR product was inserted into plasmid pET22b toxC , linearized with XhoI, and dephosphorylated with shrimp alkaline phosphatase (SAP). The orientation of the GT sequence was confirmed by sequencing. This resulting construct expresses the pelB - toxC -GT fusion including a C-terminal pET22b derived Hexa-Histidine (His 6 ) tag. Protein expression was performed in E. coli BL21(DE3) in the presence of plasmid pACYC184 ( pgl ) 40 . An overnight culture was used to inoculate 1 litre of 2xYT broth to an OD 600 of 0.1. Cells were grown at 37 °C until an OD 600 of 0.6 was reached. Cells were cooled on ice for 30 min, protein expression was induced by addition of IPTG to a final concentration of 0.5 mM, and cells were grown for an additional 18 hrs at 30 °C. Cells were cooled on ice, harvested by centrifugation (15 min 4, 200 × g, 4 °C), and resuspended in PBS supplemented with an EDTA free protease inhibitor cocktail according to the instructions of the manufacturer (Roche). Cells were disrupted in a cell disrupter (Constant Systems, Ltd), the resulting suspension was centrifuged for 30 min at 13, 000 × g, 4 °C, and the resulting supernatant was loaded onto a 1 ml Ni-NTA column using the AEKTA purification system (GE Healthcare). After an initial wash step with 10 mM imidazole in PBS, an imidazole gradient was applied from 10–250 mM over 50 column volumes. Elution fractions that contained the ToxC-GT-His 6 protein were analyzed by 12.5% SDS-PAGE, combined and the glycosylation status of ToxC-GT-His 6 was verified by Western blotting as described previously 35 . The ToxC-GT-His 6 proteins were dialyzed against 25 mM potassium phosphate buffer, 10 mM NaCl, pH 7.2, and further purified by anion exchange chromatography on a 2.5 ml MonoQ column (GE Healthcare) with a 100 ml linear gradient of NaCl (10–500 mM) in 25 mM potassium phosphate, pH 7.2. Fractions containing ToxC-GT-His 6 were desalted by size exclusion chromatography on a Sepahadex 75 column using PBS as the mobile phase. Fractions that contained the target protein as determined by 10% SDS-PAGE and Western blotting with R1-4 antisera were combined. The protein concentration was determined using the BioRad DC protein assay kit according to the instructions of the manufacturer and adjusted to 0.2 mg/ml. The N-glycan amount per protein was calculated after determination of the carbohydrate content of ToxC-GT-His 6 using the colorimetric phenol-sulfuric assay 73 and known concentrations of purified fOS (free oligosaccharides) 74 as a standard. If necessary, centrifugal filters (Amicon, 10 kDa cut-off) were used to concentrate the proteins. Proteins were stored at 4 °C until further use.

Preparation of E. coli cells for downstream processing

E. coli K12 wzy :: kan (KEIO collection 75 ) was transformed with plasmids pACYC184 ( pgl mut ) and pACYC184. Whole cells for vaccination and verification of antigen expression were prepared as follows: overnight cultures were used to inoculate fresh 2xYT broth to an OD 600 of 0.1. Cells were grown at 37 °C without antibiotics until an OD 600 of at least 1.0 was reached. Cells were cooled on ice (10–15 min), harvested by centrifugation (5 min 4, 200 × g, 4 °C), washed twice in ice-cold PBS and adjusted to an OD 600 of 1.0 using the same buffer.

Cell counts were determined as follows: aliquots of a 10-fold dilution series (prepared in PBS) of cells adjusted to an OD 600 of 1.0 were plated on 2xYT plates containing Km and Cm. Colony forming units (CFUs) were in a range of 0.9 to 1.1 × 10*8 bacteria per 1 ml of OD 600 = 1.0 cells. To adjust the vaccination dose, cells were resuspended in 1/3 of the original OD 600 = 1.0 volume resulting in 3 × 10*8 cells per ml (or 1 × 10*8 cells in 300 μl = one dose). Alternatively cells were cross-linked/fixed using 1% formaldehyde in PBS for 1 h at 4 °C as previously described 76, centrifuged (5 min 4, 200 × g, 4 °C), and washed 4-times with ice-cold PBS. Cross-linked cells were resuspended in PBS that corresponded to 1/3 of the original volume of the OD 600 = 1.0 cell suspension to obtain 3 × 10*8 cells/ml (that equals 1 × 10*8 cells in 300 μl that were needed for one dose of the inactivated whole cell-based vaccine).

Preparation of protein free cell extracts

Glycolipid extracts were prepared as previously described 77 . Briefly, E. coli cells of a culture equivalent to an OD 600 of 1.0 (prepared as described above) were centrifuged, resuspended in 100 μl of 1 × Laemmli sample buffer, and heated to 95 °C for 10 min. Proteinase K (Fermentas) was added to a final concentration of 200 μg/ml and the sample was incubated at 60 °C for 1 h. Glycolipid species from the proteinase K-digested whole cell lysates were separated by 12.5% SDS-PAGE, transferred to PVDF membranes and analyzed by Western blotting as previously described 35 .

Cross absorption of R1 antiserum

C. jejuni N-glycan-specific antiserum (R1 35 ) was cross absorbed using whole cells of E. coli wzy :: kan (pACYC184) as follows: the pellet of 1 ml of OD 600 = 1.0 culture was blocked with 1 ml PBS and 5% skim milk for 20 min. Cells were spun for 5 min at 4, 200 × g, resuspended and incubated with 1 ml of R1 serum for 30 min on ice with occasional inversion of the tube. Cells were spun out of the mixture and the supernatant was used to repeat the procedure 4X. The resulting serum (R1-4) that was depleted of E. coli -specific antibodies was used for downstream analyses.

Western blotting

Western blots were performed as previously described 35 . C. jejuni -N-glycan-specific antiserum, R1, or cross-absorbed R1 (R1-4) was used at a 1:7, 500 dilution, anti-His antiserum (Santa Cruz Biotech) was used at a 1:1, 000 dilution, and AP-conjugated rabbit and mouse antisera (Santa Cruz Biotech) were used at 1:2, 000 dilutions. Immunoreactive bands were visualized directly on the PVDF membrane using the NBT-BCIP detection reagents (Promega) according to the instructions of the manufacturer.

Colony lifts

Cecal content dilutions were plated on MH agar supplemented with the Karmali supplement and Trimethoprim. Colony lifts were performed as previously described 78 . Immunodetection was done as for Western blotting (described above).

Fluorescence activated cell sorting (FACS)

E. coli cells were adjusted to OD 600 of 1.0 and 1 ml was pelleted by centrifugation and resuspended in 1 ml blocking solution (PBS, 5% skim milk). Cells were probed with R1-4 and Alexa Flour-546 conjugated anti-rabbit antiserum, and analyzed by FACS (on a LSR-Fortessa Flow Cytometer). FACS data were processed with the FACS Diva software. DAPI counter-staining was used to identify and gate for intact cells.

NMR

Glycolipids were prepared from cell pellets obtained from eight litres of OD 600 = 1.0 E. coli wzy :: kan (pACYC184 pgl mut ) cells grown as described above. LPS was extracted by phenol-water, dialyzed, treated with acetic acid (AcOH) to precipitate nucleic acids, dialyzed, dried, hydrolyzed with 2% AcOH and separated on Biogel P6. Fractions were analyzed by NMR. Fractions that contained C. jejuni N-glycan signals were combined and separated on an anion-exchange Hitrap column using an NaCl gradient. Fractions were again analyzed by NMR. C. jejuni N-glycan LPS-core components eluted as a broad peak after the enterobacterial common antigen peak (data not shown). Fractions containing C. jejuni N-glycan signals were desalted by Sephadex G-15 chromatography. Connections were confirmed by NOE and HMBC.

Chicken challenge studies

Animal studies were carried out in accordance with the protocol approved by the Animal Care and Use Committee at the University of Alberta using a 35 day challenge protocol. In general each group contained up to 8 birds (SPF Leghorns, Poultry Research Facility, University of Alberta) that were randomly tested for the presence of C. jejuni on the day of hatch (day 1) by plating cloacal swabs onto selective Karmali agar. In all cases no C. jejuni colonies were observed on plates after 48 hr of incubation under microaerobic conditions at 37 °C.

Chicken vaccination

To test the efficacy of the protein glycoconjugates, birds received 300 μl of protein antigen prepared 1:1 in Freund's complete adjuvant for the 1 st vaccination (day 7) and the same amount but with Freund's incomplete adjuvant for the 2 nd vaccination (day 21). Antigens were injected at two sites in the chest with 150 μl of vaccine formulation per site or in the leg with 150 μl of vaccine formulation in each leg. Control groups received PBS in Freund's complete/incomplete instead of protein. Vaccination with whole cells of E. coli was done by orally gavaging 300 μl of PBS containing 1 × 10*8 live or inactivated (cross-linked, as described above) E. coli cells on days 7 and 21. Control groups were gavaged with 300 μl of PBS only. In the case of the E. coli whole cell live vaccine, cloacal swabs taken at various time points were plated onto LB Km-Cm. Relative CFUs for each bird were determined by colony counts after 18 hr of incubation at 37 °C.

Campylobacter challenge

Birds were orally gavaged (challenged) on day 28 with either PBS (negative control) or with 300 μl PBS containing 10*2 or 10*6 C. jejuni strain 81–176 cells. To prepare the challenge, C. jejuni 81–176 was grown for 18 h on MH agar and harvested with cold MH broth. Cells were washed twice with cold PBS and adjusted to an OD 600 of 1.0 (OD 600 of 1.0 equals 1.5 × 10*9 cell/ml). Serial dilutions in PBS were performed dependent on the final amount of cells that were administered. For example: 3 × 10*2 cells/ml (=1 × 10*2 cells per 300 μl =1 dose). Cells were maintained on ice until used. Birds were maintained for 7 days after challenge and then euthanized according to the approved guidelines of the Canadian Council for Animal Care. Ceca were collected, the contents were removed and weighed and adjusted to 1 mg cecal content per 1 ml with sterile PBS. Aliquots of 10-fold serial dilutions (in PBS) of the cecal contents were plated on selective Karmali agar. CFU were determined after incubation of the plates for 48 hr under microaerobic conditions.

Serum preparation

Blood samples were collected on day 7 (50 μl pre-bleed) and day 28 (100 μl vaccine response prior to challenge). Fresh blood samples were kept at room temperature for at least 18 hr or at 37 °C for at least 6–8 hr, until a firm blood clot was formed. Samples were centrifuged (5 min, 13, 000 × g, 4 °C) and the supernatant (serum) was transferred to a fresh tube. After addition of glycerol to a final concentration of 10%, the sera were stored at −20 °C until further use.

ELISA testing for N-glycan-specific antibodies

We developed a 96-well plate ELISA assay to quantify the N-glycan-specific IgY responses in vaccinated birds. fOS from C. jejuni (Cj) was prepared as described 74 and coupled to BSA by reductive amination as previously described 35 . Formation of the BSA-Cj-N-glycan conjugate was confirmed by Western blotting using R1-4 antiserum. After adjusting the concentration to 1 mg/ml using PBS, the glycoconjugate was stored at 4 °C until further use. We first tested the BSA-Cj-N-glycan conjugate binding capacity by coupling increasing amounts of the antigen and probed with R1-4 antiserum. A linear increase in signal intensity was observed over a range of 5 to 500 ng of the capture antigen (data not shown). No increase in signal intensity was observed when higher concentrations of the BSA-Cj-N-glycan conjugate were added to each well, therefore 500 ng of BSA-Cj-N-glycan conjugate per well were used for further analyses.

Then, 96-well Maxisorb plates (Thermo Fisher) were coated with 500 ng of BSA-Cj-N-glycan conjugate overnight (18 hr) at 4 °C. After removal of unbound antigen, the plate was blocked for 1 hr at RT with 5% skim milk in 100 μl PBS-T with shaking. After discarding the blocking solution, 100 μl of the antibody solution was added and incubated for 1 hr as described above. Antibody solutions were R1-4 antiserum diluted 1:3000 in PBS-T with 1% skim milk, or chicken serum (prepared from day 28 bleeds from the 2 nd vaccination experiment, Fig. 3B), diluted 1:10 in PBS-T with 1% skim milk. Plates were incubated for 1 hr at RT as described and each well was washed 3 times for 5 min with 100 μl of PBS-T. After addition of 100 μl of the secondary antibody solution (either anti-rabbit-AP (1:500), for the R1-4 control or anti-chicken IgY (1:500) for the experimental samples and incubated for 1 hr at RT), the secondary antibody solutions were discarded and the wells were washed 4 × 5 min with 100 μl of PBS-T. After the last washing step, the remaining washing solution was completely removed from each well and the plates were developed using pNPP as a substrate following the instructions of the manufacturer (Thermo Fisher). Immunoreactivity in each serum was determined after scanning the plate at OD 405 in a plate reader.

Chicken microbiome studies

Chicken microbiome studies were performed to analyze and compare the composition of the bacterial community in negative control (non-vaccinated, not challenged) and positive control (non-vaccinated, challenged) birds in comparison with birds that were challenged with C. jejuni after they received the E. coli live vaccine strain that expresses the N-glycan on its surface.

DNA isolation

First, 250–300 mg of cecal contents were placed in a 2 ml tube and washed with cold 1xSTE buffer (100 mM NaCl, 1 mM EDTA, 10 mM Tris/HCl pH 8.0). The sample was spun at low speed (1, 000 rpm) to remove large pieces of unwanted debris. The supernatant was placed in a new 2 ml tube and spun at a higher speed 14, 500 rpm on the mini-spin) to pellet the bacteria in the sample. The supernatant was removed; the pellet was resuspended by vortexing and was washed twice with 1 ml of ice cold 1xSTE buffer. After removing the supernatant, 180 μl of Qiagen ATL was added with 20 ml of Roche PK and digested overnight at 56 °C on a rotisserie. The DNA was extracted on the Biosprint using the Biosprint_96_DNA tissue and blood kit© according to the QIAGEN protocol. The DNA samples were quantified using the Promega QuantiFlour®dsDNA System kit.

Library preparation and quantification

Extracted DNA from chicken cecum samples was initially amplified using the universal primers 926F (5′-AAACTYAAAKGAATWGRCGG-3′) and 1392R (5′-ACGGGCGGTGWGTRC-3′) that targets the V6 to V8 region of the 16S ribosomal RNA gene with PCR conditions as detailed in the 16S Metagenomic Sequencing Library Preparation (Illumina®, San Diego, CA). A bioanalyzer trace of amplified products was obtained using the DNA 1000 chip on Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). Amplicons with a single product at approximately 500 bp were determined to be suitable for further library preparation. Subsequently PCR cleanup was carried out using the Agentcourt Ampure XP beads (Beckman Coulter, Mississauga, ON). Nextera XT Dual indexing barcodes adapters (Illumina®) were attached to the bead-cleaned amplicons by a second PCR as detailed in the 16S Metagenomic Sequencing Library Preparation (Illumina®). Barcoded amplicons were cleaned up by an additional step of Agentcourt Ampure XP bead clean up (Beckman Coulter). ABI Veriti 96 well Thermal Cycler (Life Technologies, Burlington, ON) was used to run all the PCR reactions. Library quality was assessed by running the DNA1000 chip on the Agilent 2100 Bioanalyzer (Agilent Technologies). Library sizes ranged from 630 to 670 bp. Qubit HS dsDNA Assay (Life Technologies) was used to quantify the libraries. Individual libraries with their respective barcodes were pooled in a 4 nM library pool. The 16S rRNA gene sequencing was carried out on the Illumina MiSeq sequencer with the MiSeq Reagent kit V3 (Illumina) generating 300 bp reads in both the forward and reverse directions.

Microbiome - data analysis

Illumina 16S rRNA sequence reads were processed and analyzed as previously described 79 with minor modifications as follows. Reads were trimmed to 300 bp using FASTX-Toolkit (//hannonlab.cshl.edu/fastx_toolkit/) and paired-end reads were merged using the merge-illumina-pairs application (//github.com/merem/illumina-utils) with the following quality parameters: p-value = 0.03, enforce Q30 check, no ambiguous nucleotides and perfect matching to primers. An average of 227, 278 merged reads per sample was obtained. Files exceeding 150, 000 reads were subsampled to that amount of reads using Mothur v.1.32.0 to standardize the depth of analysis across samples, while all reads were kept for two samples in the dataset that had less than 150, 000 reads (84, 462 and 101, 732 reads). Merged sequences between 440 and 470 bp long were kept for analysis. USEARCH v.7.0.1001 was used to remove potential chimeras and to cluster the reads into operational taxonomic units (OTUs) using a 98% similarity cut-off. Taxonomic classification at the Phylum, Family and Genus level was assigned using the Ribosomal Database Project Multiclassifier v.1.1 tool. Taxonomic classification for the OTUs was done by selecting the highest percent identity for the OTUs representative sequences (selected by the UPARSE-OTU algorithm based on read abundance) when blasted against the Greengenes database, and confirmed through NCBI Blast and RDP SeqMatch. Percent proportions were calculated based on the total number of reads per sample. Diversity metrics were calculated using MacQIIME version 1.8.0. One-way analysis of variances (ANOVA) with Tukey's post hoc test was used to compare bacterial composition and differences in diversity between the treatments. Statistical analysis was performed using GraphPad Prism version 6.0 (GraphPad Software, La Joya, CA, USA).

ytterligare information

How to cite this article : Nothaft, H. et al . Engineering the Campylobacter jejuni N-glycan to create an effective chicken vaccine. Sci. Rep . 6, 26511; doi: 10.1038/srep26511 (2016).

Kompletterande information

Word-dokument

  1. 1.

    Kompletterande information

kommentarer

Genom att skicka en kommentar samtycker du till att följa våra villkor och gemenskapsriktlinjer. Om du finner något missbruk eller som inte överensstämmer med våra villkor eller riktlinjer ska du markera det som olämpligt.