Eikosapentaensyra dämpar dexametasominducerad apoptos genom att inducera adaptiv autofagi via gpr120 i murina benmärgs-härledda mesenkymala stamceller | celldöd och sjukdom

Eikosapentaensyra dämpar dexametasominducerad apoptos genom att inducera adaptiv autofagi via gpr120 i murina benmärgs-härledda mesenkymala stamceller | celldöd och sjukdom

Anonim

ämnen

  • Negativa effekter
  • apoptos
  • Cell signalering
  • Mesenkymala stamceller

Abstrakt

Långvarig användning av glukokortikoider är ett utbrett kliniskt problem, som för närvarande inte har någon effektiv annan lösning än att avbryta användningen. Eicosapentaenoic acid (EPA), en omega-3-långkedjigt fleromättad fettsyra (n-3 PUFA), som till stor del finns i fisk eller fiskolja, har rapporterats främja cellens livskraft och förbättra benmetabolismen. Emellertid är lite känt om effekterna av EPA på dexametasom (Dex) -inducerad cell apoptos. I denna studie visade vi att EPA-inducerad autofagi av murina benmärgs-härledda mesenkymala stamceller (mBMMSC). Samtidigt inhiberade EPA, men inte arachidonsyra (AA), markant Dex-inducerad apoptos och främjade livskraften hos mBMMSC. Vi observerade också att EPA-inducerad autofagi modulerades av GPR120, men inte GPR40. Ytterligare experiment visade att mekanismen för EPA-inducerad autofagi förknippad med GPR120-modulering involverade en ökning av den aktiva formen av AMP-aktiverat proteinkinas och en minskning av aktiviteten hos däggdjursmålet för RAPA. Den skyddande effekten av EPA på Dex-inducerad apoptos via GPR120-mediterad induktion av adaptiv autofagi stöds av experiment in vivo . Sammanfattningsvis kan våra resultat ha viktiga konsekvenser för att utveckla framtida strategier för att använda EPA i förebyggande och terapi av biverkningar som orsakas av långvarigt Dex-missbruk.

Huvudsaklig

Dexametason (Dex) är en potent syntetisk medlem av glukokortikoidklassen (GC) av steroidläkemedel som används i stor utsträckning för att reglera olika utvecklings- och metabola processer inklusive benombyggnad. 1 Biverkningar inklusive benförlust, låg benmineraltäthet och ökad sprickrisk begränsar dock långvarig användning av GC: er. Tidigare studier har visat att långvarig och hög dos av Dex inducerar apoptos i benmärgs-härledda mesenkymala stamceller (BMMSC). Vidare kan faktorer som verkar genom att inducera apoptos av BMMSC leda till benförlust och olika skelettmetabolsjukdomar. 2, 3 På grund av den utbredda användningen av detta läkemedel i kliniska miljöer kommer upptäckten av nya lösningar för att förhindra apoptotisk effekt av Dex och för att hämma benförlust vara fördelaktigt för patienter som lider av skelettsjukdomar såsom osteoporos.

Fleromättade fettsyror (PUFA), som under lång tid enbart ansågs vara en energikälla i våra kroppar, har visat sig vara mycket biologiskt aktiva molekyler. De två stora familjerna av PUFA: er omega-3 (n-3) och omega-6 (n-6) PUFA, vars förhållande i kroppen är av högre betydelse än de absoluta nivåerna av en viss fettsyra. 4 Det har observerats att eikosapentaensyra (EPA), en medlem av nFA-familjen PUFA, ökar cellproliferationen och utövar anti-apoptotiska effekter via olika mekanismer inklusive modulering av autofagi, 4, 5 medan arachidonsyra (AA), en medlem av nFA-familjen PUFA, utövar motsatta effekter. 6 GPR120 och GPR40 är G-proteinkopplade fettsyrareceptorer, och många studier har visat att EPA och AA är endogena ligander för dessa receptorer, 7, 8 som har implicerats i många nyckelprocesser och utövar flera funktioner. 9, 10, 11 Våra tidigare verk har visat att aktivering av GPR120 hämmar Dex-inducerad apoptos och bestämmer den bi-potentiella differentieringsstyrkan på ett dosberoende sätt. 3, 12 Det är emellertid inte känt om EPA eller AA, endogena ligander av GPR120, skyddar mBMMSC från Dex-inducerad apoptos.

Autofagi kännetecknas av sekwestrering av bulkcytoplasma och organeller i autofagiska dubbel- eller multimembranblåsor och deras efterföljande nedbrytning med lysosomer för makromolekylär syntes och ATP-generering. 13 Flera studier har visat att autofagi reglerar cellproliferation och funktion hos osteoklaster, 14 osteoblaster, 15 och osteocyter, 16 vilket antyder att autofagi är en viktig process för benhomeostas. Dessutom har vår tidigare studie visat att autofagi är involverat i GC-inducerade rBMSC-skador. 17

Även om bevis tyder på att EPA eller AA kan skydda celler från apoptos, har EPA: s roll i induktionen av den autofagiska vägen i mBMMSC ännu inte undersökts. Det är inte känt om autofagi induceras vid Dex-inducerad apoptos och i så fall hur autofagi bidrar till cellapoptos. I den aktuella studien undersökte vi lägena och molekylära mekanismerna för mBMMSCs autofagi som är involverade i den anti-apoptotiska effekten av EPA. Så vitt vi vet, ger denna studie de första bevisen på att EPA-behandling leder till autofagi via GPR120-medierad AMPK / mTOR-signalering och att EPA-inducerad autofagi skyddar celler från Dex-inducerad apoptos. Sammantaget utvecklar våra resultat en bättre förståelse för en unik mekanism för skyddande åtgärder av EPA och GPR120 mot biverkningar som orsakas av långvarig användning av Dex.

Resultat

Tidigare och aktuella studier har visat att höga koncentrationer av Dex, särskilt 10 −6 M, orsakade apoptos i murina BMMSC (kompletterande figur 1A, B). 3 För att ytterligare klargöra om Dex inducerar autofagi i mBMMSC behandlades celler med ökande koncentrationer av Dex. Efter en 24-timmars kultur av Dex detekterades LC3-nivå med användning av Western blot- och reverstranskriptionspolymeraskedjereaktion (RT-PCR). Resultaten visade att 10 −8 och 10 −7 M Dex något uppreglerade uttrycket av LC3-nivåer och 10 −9 och 10 −7 M Dex ökade proteinnivån för LC3 (LC3-2 / LC3-1), men skillnaden från kontrollnivåer var inte statistiskt signifikant. Även om 10–6 M Dex markant inducerade apoptos i mBMMSC: er ökade det inte markant LC3-nivåerna, vilket indikerade att Dex inte markant kunde inducera autofagi i mBMMSC (kompletterande figur 1C, D). För att utvärdera autofagiflöde vid Dex-behandling behandlades celler i närvaro eller frånvaro av 10 - 6 M Dex och 200 nm Bafilomycin Al (Baf), som är den lysosomala hämmaren för att övervaka autofagiskt flöde. Resultaten visade att Baf markant kunde inducera LC3-ackumulering och ökade LC3-nivåer oavsett Dex tillsattes eller inte, vilket ytterligare visade att Dex ensam varken kunde markant inducera autofagi eller blockera autofagi-flöde (Kompletterande figur 1E, F).

EPA, men inte AA, inducerade autofagi och hämmade Dex-inducerad apoptos i mBMMSC in vitro

EPA och AA härrör från essentiella fettsyror, som knappast kan syntetiseras in vivo . För att bestämma rollen för EPA och AA i Dex-inducerad apoptos odlades celler med 10 - 6 M Dex i närvaro av ökande koncentrationer av EPA eller AA under 24 timmar. Våra resultat visar att behandling med EPA, inte AA, minskade andelen apoptotiska celler inducerade av Dex (figur 1a och b) och förbättrad cellviabilitet (figur 1c). EPA, inte AA, inducerade också en dosberoende hämning av caspase-3 (figur 1d). Och som visas i figur 1e minskade EPA antalet TUNEL-positiva celler signifikant, medan AA inte blockerade effekten av Dex. När det gäller autofagi observerade vi en dosberoende ackumulering av många lamellstrukturer med cytosoliska autofagiska vakuoler i mBMMSC efter behandling med 10 - 6 M Dex i närvaro av EPA, men inte AA (figur 1f). I överensstämmelse med denna observation visade immunofluorescensanalys att Dex-behandling med EPA ökade andelen LC3-positiva celler jämfört med Dex-behandlad grupp och kontrollgrupp (celler odlade med samma dos av fordonet) (figur 1g och h). Vi observerade dock inga markanta skillnader i LC3-positiva celler mellan AA och Dex-behandlade grupper. Eftersom autofagiska vesiklar också ackumuleras när autofagisk vesikelomsättning (autofagosom-lysosomfusion eller / och nedströms lastnedbrytning) är ineffektiv, 18 frågade vi om EPA inducerar autofagisk vakuolisering genom att försämra autofagisk vesikelomsättning. Vi bedömde därför LC3- och p62-nivåer, som är associerade med de slutförda autofagosomerna. Såsom visas i figur 1i och k ökades LC3-nivåerna markant efter behandling med EPA jämfört med Dex och kontrollgrupperna. Däremot inducerade EPA en dosberoende reduktion i p62-nivån (figurerna 1j och k). Dessa fynd antyder att autofagisk vesikelomsättning inte försämras av EPA och att EPA-inducerad autofagisk vakuolisering är en följd av autofagisk flödesaktivering. I korthet inducerade EPA, inte AA, autofagiskt flödesaktivering och inhiberade Dex-inducerad apoptos av mBMMSC på ett dosberoende sätt.

Image

EPA, men inte AA, inducerade autofagi och hämmade Dex-inducerad apoptos i mBMMSC in vitro . mBMMSC behandlades med Dex ( 10-6 M) i frånvaro eller närvaro av EPA eller AA under 24 timmar. ( a och b ) Annexin V / PI dubbelfärgning utfördes för att detektera apoptotiska celler. ( c ) EPA eller AA applicerades på mBMMSC vid koncentrationer av 10, 40 och 100 μm . Kulturerna inkuberades med Dex ( 10-6 M) under 24 timmar i närvaro eller frånvaro av EPA eller AA och därefter bestämdes cellviabilitet genom MTT-analys. ( d ) Caspase-3-aktivitet detekterades med caspase-3-analyspaketet i mBMMSC som behandlades med Dex (10 - 6 M) i frånvaro eller närvaro av EPA eller AA under 24 timmar. ( e ) Cellapoptos detekterades genom TUNEL-analys och antalet TUNEL-positiva celler i procent av de positivt färgade mBMMSC: erna. ( f ) Fasta celler bearbetade för tunn-sektions elektronmikroskopi. Pilarna indikerar autofagiska vakuoler som digererar organeller eller cytosoliskt innehåll (förstoring, × 2500). ( g ) Konfokal mikroskopisk analys av mBMMSC efter immunofluorescerande färgning med användning av en anti-LC3-antikropp märkt cytoskeletten med falloidin och märkt med kärnmarkören DAPI (förstoring, × 200). LC3, röd; falloidin, grön; kärnor, blå. ( h ) Antal LC3-positiva celler i procent av de positivt färgade mBMMSC: erna. ( i och j ) RT-PCR-analys av LC3 och p62 behandlade med vissa grupper. Expression av varje målgen beräknades som expression i förhållande till p- aktin och representerades som normaliserad vikningsexpression. ( k ) Western blot-analys och kvantifiering av LC3 (LC3-2 / LC3-1) och p62 (p62 / GAPDH) -protein behandlat med vissa grupper. Uppgifterna representeras som medelvärde ± SD för tre oberoende experiment. * P <0, 05 jämfört med kontrollceller (celler odlade i samma doser av vehikel utan Dex, EPA och AA), # P <0, 05 jämfört med 10 −6 M Dex-behandlade celler. BMMSC, benmärgs-härledda mesenkymala stamceller; Dex, dexametason; PI, propidiumjodid; EPA, eikosapentaensyra; AA, arakidonsyra, LC3, mikrotubuli-associerad protein 1 lätt kedja 3

Bild i full storlek

EPA inhiberade Dex-inducerad apoptotisk celldöd via induktion av adaptiv cell autofagi

Eftersom EPA utlöste autofagi och samtidigt hämmade Dex-inducerad apoptos in vitro , siktade vi att bestämma om autofagi påverkade EPA-inducerad anti-apoptotisk celldöd. BMMSC odlades med 10-6 M Dex och 100 μ M EPA under 24 timmar i närvaro eller frånvaro av 100 nM rapamycin (RAPA) och 5 m M 3-metyladenin (3-MA). Dessutom upptäckte vi effekten av RAPA och 3-MA ensam i närvaro av Dex. Såsom visas i figur 2a ökades autofagiska vakuoler i mBMMSC efter behandling med 10 - 6 M Dex och 100 mikrometer EPA i närvaro av 100 nM RAPA, medan 5 mM 3-MA hämmade ackumuleringen av autofagiska vakuoler. Totalt minskade 5 mM 3-MA också starkt LC3-nivå inducerad av EPA, medan RAPA ökade den (figurerna 2b och c). Dessutom blockerade hämning av autofagi med 5 mM 3-MA delvis den skyddande effekten av EPA i hämningen av Dex-inducerad apoptos och ökade markant den apoptotiska celldöd, bestämd av den ökade andelen apoptotiska celler, lägre cellviabilitet, ökade nivåer av caspase-3-aktivitet och det ökade antalet TUNEL-positiva celler (figurerna 2d – g). Aktivering av autofagi genom RAPA förstärkte ytterligare den skyddande effekten av EPA, men det fanns inga signifikanta skillnader mellan dessa två grupper (EPA och EPA + RAPA). Även om RAPA enbart kunde inducera cellautofagi i stor utsträckning, kunde det inte hämma Dex-inducerad apoptos, vilket indikerade att EPA kan ha en viss bonus på cellviabilitet och direkt skyddade celler från Dex-inducerad apoptos och typen av EPA- eller RAPA-inducerad autofagi kanske inte är detsamma. För att bättre ta itu med denna punkt ville vi veta om EPA kunde inducera autofagi utan Dex och om EPA-induktionseffekten av EPA orsakades av att blockera autofagi-flöde. Cellerna behandlades med eller utan 10 M M Dex och 100 μM EPA i närvaro eller frånvaro av 200 nM Baf. Resultatet visade att EPA enbart inte kunde inducera autofagi utan Dex eftersom EPA-behandling inte kunde markant öka LC3-nivåerna jämfört med Baf eller Baf + EPA-behandlad grupp utan Dex, och Baf kunde markant inducera LC3-ackumulering oavsett Dex tillsattes eller inte, vilket indikerade att EPA kunde utlösa adaptiv autofagi på grund av Dex-inducerad apoptotisk celldöd och denna effekt var inte genom att blockera autofagi-flöde (kompletterande figur 2A, B). För att ytterligare bekräfta involvering av EPA-inducerad autofagi i skyddet mot Dex-inducerad apoptos, använde vi Atg7 små störande RNA (siRNA) för att blockera autofagiprocessen och för att undvika påverkan från andra cellulära signaländringar påverkade av 3-MA. RT-PCR och western blot visade att Atg7 markant slogs ned (kompletterande figur 3A, B). Tunnsektionselektronmikroskopisk analys, RT-PCR och western blot visade att knockdown av Atg7 markant inhiberade cellautofagi, och EPA kunde inte öka LC3-nivån och inducera några autofagiska vakuoler i Atg7 slog ner mBMMSC (figur 2h – j). Vad mer är, Atg7 siRNA dämpade signifikant den skyddande effekten av EPA vid hämning av Dex-inducerad apoptos (figurerna 2k – n). Tillsammans indikerade dessa resultat starkt att EPA-inducerad adaptiv autofagi var relaterad till apoptotisk celldöd och åtminstone delvis kunde hämma Dex-inducerad apoptos.

Image

EPA inhiberade Dex-inducerad apoptotisk celldöd via inducerande adaptiv cell autofagi. mBMMSC odlades med eller utan 10 M M Dex och 100 μ M EPA under 24 timmar i närvaro eller frånvaro av 100 nM rapamycin (RAPA) och 5 mM 3-metyladenin (3-MA). ( a ) Fasta celler bearbetade för tunn-sektions elektronmikroskopi. Pilarna indikerar autofagiska vakuoler som digererar organeller eller cytosoliskt innehåll (förstoring, × 2500). ( b ) RT-PCR-analys av LC3 behandlad med vissa grupper. ( c ) Western blot-analys och kvantifiering av LC3 (LC3-2 / LC3-1) protein behandlat med vissa grupper. ( d ) Annexin V / PI dubbelfärgning utfördes för att detektera apoptotiska celler. ( e ) Caspase-3-aktivitet detekterades med caspase-3-analyspaketet i mBMMSCs som behandlades med eller utan 10 M M Dex och 100 μ M EPA under 24 timmar i närvaro eller frånvaro av 100 nM rapamycin (RAPA) och 5 mM 3-metyladenin (3-MA). ( f ) Kulturerna inkuberades med eller utan Dex ( 10-6 M) och 100 μM EPA under 24 timmar i närvaro eller frånvaro av 100 nM rapamycin (RAPA) och 5 mM 3-metyladenin (3-MA). Cellviabilitet bestämdes genom MTT-analys. ( g ) Cellapoptos detekterades genom TUNEL-analys och antalet TUNEL-positiva celler i procent av de positivt färgade mBMMSC: erna. Expression av varje målgen beräknades som ett relativt uttryck för p- aktin och representerades som normaliserat vik-uttryck. ( h ) Atg7 slogs ner av siRNA och celler odlades med 10 6 M Dex med eller utan 100 μM EPA. Fasta celler bearbetade för tunn-sektions elektronmikroskopi. Pilarna indikerar autofagiska vakuoler som digererar organeller eller cytosoliskt innehåll (förstoring, × 2500). ( i och j ) RT-PCR, Western blot-analys och kvantifiering av LC3 (LC3-2 / LC3-1) behandlade med vissa grupper. ( k ) Annexin V / PI dubbelfärgning utfördes för att detektera apoptotiska celler. ( l ) Caspase-3-aktivitet detekterades med caspase-3-analyssatsen i kontroll eller Atg7 slog ner mBMMSC. ( m ) Cellviabilitet bestämdes genom MTT-analys. ( n ) Cellapoptos detekterades med TUNEL-analys och antalet TUNEL-positiva celler i procent av de positivt färgade mBMMSC: erna. Uppgifterna representeras som medelvärde ± SD för tre oberoende experiment. * P <0, 05 jämfört med varje grupp ( a - g ). * P <0, 05 jämfört med kontroll siRNA behandlad med EPA ( i - n ). 3-MA, 3-metyladenin; RAPA, rapamycin

Bild i full storlek

GPR120, men inte GPR40, förmedlar EPA-inducerad autofagi och den efterföljande anti-apoptotiska effekten

GPR120 och GPR40 är G-proteinkopplade fettsyrreceptorer, som är belägna på membranet från olika celltyper och har varit inblandade i många viktiga cellulära processer. 7, 19, 20 Vår tidigare studie var den första som undersökte uttrycket och funktionerna för GPR120 och GPR40 i mBMMSC och visade att GPR120 modulerar anti-apoptotiska effekter i dessa celler. 3 I denna studie undersökte vi om GPR120 och GPR40 påverkade EPA-inducerad autofagi och anti-apoptotisk celldöd i BMMSC. Såsom visas i figurerna 3a och b slogs GPR40 och GPR120 mRNA och proteinnivån fullständigt ned genom användning av shRNA. Vi odlade sedan dessa celler med 10 −6 M Dex och 100 μM EPA. Nedslagningen av GPR120, inte GPR40, minskade markant LC3-nivån, vilket indikerar att GPR120 har en väsentlig roll i EPA-inducerad autofagi (figur 3c och d). Vidare försämrade GPR120 shRNA till stor del den anti-apoptotiska effekten av EPA jämfört med GPR120 kontrollgrupp, vilket visas av den minskade cellviabiliteten, ökad andel apoptotiska celler och TUNEL-positiva celler och ökade nivåer av caspase-3-aktivitet i GPR120 shRNA-behandlad celler (figur 3e – h). GPR40-knockdown påverkade emellertid inte EPA-inducerad autofagi eller utövade en anti-apoptotisk effekt i detta odlingssystem.

Image

GPR120, men inte GPR40, modulerade EPA-inducerad autofagi för att hämma Dex-inducerad apoptos. GPR120 och GPR40 slogs ner av shRNA och celler odlades med 10 6 M Dex och 100 μM EPA. ( a och b ) RT-PCR och western blot-analys av GPR120 och GPR40. mBMMSC: er ogiltiga för GPR120 och GPR40-expression eller transfekterades med en icke-målsökande vektor. ( c och d ) RT-PCR, Western blot-analys och kvantifiering av LC3 (LC3-2 / LC3-1) protein behandlat med vissa grupper. ( e ) Annexin V / PI dubbelfärgning utfördes för att detektera de apoptotiska cellerna. ( f ) Caspase-3-aktivitet detekterades med caspase-3-analyspaketet i mBMMSC som behandlades med 10 −6 M Dex och EPA under 24 timmar. ( g ) Kulturer inkuberades med Dex ( 10-6 M) och EPA under 24 timmar och cellviabilitet bestämdes genom MTT-analys. ( h ) Cellapoptos detekterades genom TUNEL-analys och antalet TUNEL-positiva celler i procent av de positivt färgade mBMMSC: erna. Expression av varje målgen beräknades som ett relativt uttryck för p- aktin och representerades som normaliserat vik-uttryck. Uppgifterna representeras som medelvärde ± SD för tre oberoende experiment. * P <0, 05 jämfört med GPR120- eller GPR40-kontrollceller (celler transfekterade med en icke-målsökande vektor)

Bild i full storlek

EPA inducerar autofagi genom GPR120-medicinerad AMPK / mTOR-signalering

Efter att ha visat att GPR120-medierad EPA-inducerad autofagi, ville vi ytterligare belysa EPA: s nedströmsmål. mTOR har en avgörande roll i kontrollen av autofagi genom att integrera information från flera uppströms signaltransduktionsvägar och negativt reglera autofagi. 21, 22 Kända nedströmsmål för GPR120 som kan vara involverade i modulering av mTOR-signalering tillhör huvudsakligen fyra signalvägar: Ras-Erk1 / 2, 12 PI3K-AKT, 23 p38-MAPK, 24 och AMPK. 25 Vi odlade celler med 10 M M Mx och 100 μM EPA i närvaro eller frånvaro av hämmare av Erk1 / 2 (U0126), AKT (LY294002), p38 (SB203580) och AMPK (förening C). LC3-mRNA och proteinnivåer reducerades endast genom behandling med förening C, medan hämmare av Erk1 / 2, AKT och p38 inte kunde hämma EPA-inducerad autofagi (figur 4a). Nyligen har AMPK, ett proteinkomplex som svarar på förändringar i cellulärt AMP / ATP-förhållande, visat sig stimulera autofagi via hämning av mTOR. 26 Vi ville veta om GPR120-medierad AMPK-mTOR-signalering aktiverad av EPA var involverad i dess anti-apoptotiska effekt. Efter behandling med 10 6 M Dex odlade vi mBMMSC med 100 μM EPA i närvaro eller frånvaro av 10 μM förening C och 100 nM Everolimus, en mTOR-hämmare. Såsom visas i figurerna 4b och c minskade hämning av AMPK genom förening C LC3-nivå, vilket antydde att mBMMSC: er var mindre benägna att genomgå autofagi. För att bättre utvärdera den direkta rollen hos AMPK i hämningen av mTOR, upptäckte vi den totala och fosforyleringsproteinnivån för mTOR och S6Kinase. Resultatet visade att hämning av AMPK med förening C aktiverade mTOR och ökade fosforyleringen av mTOR och S6K (figur 4c). Dessutom minskade förening C cellviabiliteten, ökade andelen apoptotiska celler och TUNEL-positiva celler och ökade kaspas-3-aktivitet, vilket antydde att förening C ökade antalet celler avsedda för apoptotisk celldöd jämfört med EPA-behandling (figur 4d – g ). Vidare främjade hämningen av mTOR av Everolimus, även i närvaro av förening C, som markant uppreglerade mTOR och inducerade apoptos, den anti-apoptotiska effekten av EPA (fig. 4c – f), vilket indikerar att AMPK-mTOR-signalvägen har en ledande signal roll i EPA-inducerad autofagi och anti-apoptotisk process. Tillsammans med vår ovan nämnda iakttagelse att GPR120 reglerar EPA-inducerad autofagi, antyder dessa korrelativa data att EPA, men inte AA, inducerar adaptiv autofagi för att hämma Dex-inducerad apoptos via GPR120 (inte GPR40) -medierad AMPK / mTOR-signalering.

Image

EPA inducerar autofagi genom GPR120-medierad AMPK / mTOR-signalering. ( a ) RT-PCR, Western blot-analys och kvantifiering av LC3 (LC3-2 / LC3-1) protein. Cellerna behandlades med 10 −6 M Dex och 100 μM EPA i närvaro eller frånvaro med hämmare av 10 μM Erk1 / 2 (U0126), 10 μ M AKT (LY294002), 10 μM p38 (SB203580) och 10 μM AMPK (förening C). ( b ) RT-PCR, Western blot-analys och kvantifiering av LC3 (LC3-2 / LC3-1) protein. Efter behandling med 10 - 6 M Dex odlades celler med 100 μM EPA i närvaro eller frånvaro av 10 μM förening C och 100 nM Everolimus (mTOR-hämmare). ( c ) Western blot-analys och kvantifiering av LC3 (LC3-2 / LC3-1), mTOR (p-mTOR / mTOR) och S6K (p-S6K / S6K) protein. ( d ) Annexin V / PI dubbelfärgning utfördes för att detektera apoptotiska celler. ( e ) Caspase-3-aktivitet detekterades med caspase-3-analyspaketet i mBMMSC. ( f ) Kulturer inkuberades med 100 | im M EPA i närvaro eller frånvaro av 10 | jM Förening C och 100 nM Everolimus (mTOR-hämmare) under 24 timmar och cellviabilitet bestämdes genom MTT-analys. ( g ) Cellapoptos detekterades genom TUNEL-analys och antalet TUNEL-positiva celler i procent av de positivt färgade mBMMSC: erna. Expression av varje målgen beräknades som ett relativt uttryck för p- aktin och representerades som normaliserat vik-uttryck. Uppgifterna representeras som medelvärde ± SD för tre oberoende experiment. * P <0, 05 jämfört med celler odlade med 10 −6 M Dex och 100 μM EPA

Bild i full storlek

EPA skyddar mBMMSC från Dex-inducerad apoptos och inducerar autofagi in vivo

Våra in vitro- experiment demonstrerade att EPA, inte AA, inhiberade Dex-inducerad apoptos av mBMMSC genom att inducera adaptiv autofagi. Baserat på dessa fynd syftade vi till att bestämma om liknande resultat skulle observeras in vivo . Såsom visas i figur 5a fick 8 veckor gamla Balb / C-möss en intraperitoneal Dex-injektion med eller utan oral provtagning av ökande koncentrationer av EPA, AA eller intrabenmärgsinjektion av TUG-891, en potent och selektiv GPR120-agonist 27 i 8 veckor. Vi skördade sedan och odlade mBMMSC: er av möss från varje grupp för att undersöka styrkan av autofagi och apoptos. Vi observerade en dosberoende ackumulering av cytosoliska autofagiska vakuoler i mBMMSC efter behandling med 10 - 6 M Dex i närvaro med EPA, men inte AA. Dessutom hade 10 μM TUG-891 en liknande effekt som 100 μM EPA för att inducera ackumulering av autofagiska vakuoler (figur 5b). Jämfört med Dex-behandlad grupp, reglerade EPA markant LC3-nivån för mBMMSC på ett dosberoende sätt, medan AA inte hade någon effekt i denna process (figurerna 5c och d). Dessutom ökade TUG-891 också LC3-nivån, och effekten var inte signifikant annorlunda jämfört med gruppen behandlad med 100 μM EPA. Dessa observationer överensstämmer delvis med våra in vitro- data, som visade att EPA-inducerad autofagi via GPR120 (figurerna 5c och d). EPA-behandling hämmade också markant Dex-inducerad apoptos in vivo på ett dosberoende sätt. AA hade emellertid ingen anti-apoptotisk effekt och ökade till och med de apoptotiska markörerna (figur 5e – h). Den anti-apoptotiska effekten inducerad av TUG-891 skilde sig inte märkbart från den som inducerades genom behandling med 100 μM EPA, vilket ytterligare stöder våra in vitro- data att EPA hämmar Dex-inducerad apoptos genom att inducera adaptiv autofagi via GPR120-medierade signalvägar ( Figurerna 5e – h). Sammantaget visar våra resultat rollen för EPA, men inte AA, för att inducera adaptiv autofagi för att skydda celler från Dex-inducerad apoptos via GPR120-medierad AMPK / mTOR-signalering.

Image

EPA-skyddade mBMMSC från Dex-inducerad apoptos och inducerad autofagi in vivo . Åtta veckor gamla Balb / C-möss behandlades med intraperitoneal injektion av Dex (3, 5 mg / Kg / dag) i närvaro eller frånvaro av oral provtagning med ökande koncentrationer av EPA eller AA (0, 1, 0, 4, 1 g / Kg / dag ) eller genom intra-benmärgsinjektion av TUG-891 (10 μ mol / kg, tre gånger per vecka, potent och selektiv agonist av GPR120) under 8 veckor. mBMMSC-möss från varje grupp skördades och odlades för att undersöka styrkan av autofagi och apoptos. ( a ) Diagram över studier och behandlingsmetoder. ( b ) Fasta celler bearbetade för tunn-sektions elektronmikroskopi. Pilarna indikerar autofagiska vakuoler som digererar organeller eller cytosoliskt innehåll (förstoring, × 2500). ( c ) RT-PCR, ( d ) Western blot-analys och kvantifiering av LC3 (LC3-2 / LC3-1) -protein. ( e ) Annexin V / PI dubbelfärgning utfördes för att detektera apoptotiska celler. ( f ) Caspase-3-aktivitet detekterades med caspase-3-analyssatsen i mBMMSC. ( g ) Kulturer inkuberades med 10-6 M Dex i närvaro eller frånvaro av ökande koncentrationer av EPA eller AA (10, 40, 100 μM ) under 24 timmar och cellvärdighet bestämdes genom MTT-analys. ( h ) Cellapoptos detekterades med TUNEL-analys och antalet TUNEL-positiva celler som en procentandel av de positivt färgade mBMMSC: erna. Uttryck av varje målgen beräknades som ett relativt uttryck för p- aktin och representerade som normaliserat vikuttryck. Uppgifterna representeras som medelvärde ± SD för tre oberoende experiment. * P <0, 05 jämfört med celler odlade med 10 - 6 M Dex

Bild i full storlek

Diskussion

GC: er har använts i stor utsträckning som potenta immunsuppressiva läkemedel för behandling av en mängd olika inflammatoriska sjukdomar, inklusive reumatoid artrit och inflammatorisk tarmsjukdom, såväl som inom transplantationsmedicin. Emellertid orsakar långvarig behandling med höga doser av GC: er snabba och långvariga benförlust och bräckliga sprickor. 2 BMMSC är viktiga för att bibehålla den dynamiska homeostasen av benvävnad, med studier som visar att brister i BMMSC: s spridning och osteoblastisk differentiering är förknippade med minskad benmassa. 28, 29 Vårt tidigare arbete har visat att Dex-behandling inducerade apoptos och hämmade proliferation av mBMMSC på ett dosberoende sätt. Dessutom har vi visat att Dex, vid doser som sträcker sig från 10 −8 till 10 −6 M, inducerar autofagi i rBMMSC. 17 Baserat på dessa resultat var syftet med den aktuella studien att ytterligare undersöka rollen för dessa två processer för att bestämma cellens öde. I denna studie observerade vi inte en markant skillnad i LC3 mellan olika doser av Dex-behandling under 24 timmar. Även om 10 −9, 10 −7 och 10 −6 M Dex ökade LC3-nivåerna, var förändringen blygsam och inte signifikant annorlunda, vilket indikerar att 24 timmars Dex-behandling inte inducerar autofagi i mBMMSC. Det är anmärkningsvärt att i vår tidigare studie 10 −7 och 10 −6 M av Dex-inducerad autofagi i rBMMSC. Denna skillnad i våra resultat kan bero på olika odlingstider (24 timmar eller 48 timmar) och arter (möss eller råtta) som vi använder. I själva verket, som en process för att konsumera cellulära komponenter och generera energi, autofagi ingår i en komplex sammankoppling med apoptos beroende på typ av stimulans och celltyp. Autofagi kan undertrycka apoptos genom att eliminera skadade organeller som svar på cellstress inducerad av cancerterapi, eller det kan sensibilisera celler för apoptos i en ATP-beroende process. I denna studie visade vi att den ökade autofagi och minskade apoptos inträffade samtidigt för att hämma Dex-inducerad celldöd i EPA-behandlade mBMMSC. Däremot misslyckades AA inte bara med att hämma, utan främjade till och med den Dex-inducerade apoptosen i viss mån. Dessutom observerades morfologiska egenskaper hos ökad autofagi och minskad apoptos i EPA- men inte AA-behandlade mBMMSC, vilket ytterligare bekräftade förslaget att endast EPA (inte AA) inducerade autofagi och hämmade Dex-inducerad apoptos (figur 1f och g). Detta fynd fick oss ytterligare att undersöka sambandet mellan dessa två cellulära processer. Eventuella störningar i autofagiprocessen, såsom autofagosomansamling och lysosomdysfunktion, orsakar maladaptiv autofagi och leder till celldöd. I vår studie kan EPA ha någon bonus på cellviabilitet och direkt skyddade celler från Dex-inducerad apoptos och typen av EPA- eller RAPA-inducerad autofagi kanske inte är densamma. Beroende på detta använde vi lysosomal hämmare Baf och tystade Atg7 av siRNA och vi klargjorde ytterligare att EPA kunde utlösa adaptiv autofagi på grund av Dex-inducerad apoptotisk celldöd och denna effekt var inte genom att blockera autofagiflux. Ytterligare studier behövs för att bestämma om denna mekanism är involverad i EPA-inducerad autofagi i apoptos.

I vårt tidigare arbete visade vi att GPR120 modulerar den anti-apoptotiska effekten av Dex, bestämmer differentieringsstyrkan på ett dosberoende sätt och återhämtar benmetabolismen från östrogenbristinducerad benförlust. 3, 12 Det är emellertid inte klart om GPR120 modulerar autofagi i mBMMSC. Därför syftade vi att avgöra om GPR120 modulerar den EPA-inducerade autofagi medan hämmar apoptos och klargör mekanismen. mTOR har en central roll i kontrollen av autofagi och integrerar ingångar från flera uppströms signaltransduktionsvägar och reglerar negativt autofagi. Vi har visat att Ginsenoside-Rb2 hämmar Dex-inducerad apoptos via GPR120-medierad Ras-Erk1 / 2-kaskad och att dosberoende aktivering av GPR120 leder till aktiveringen av p38. 3, 12 Vidare har studier visat att GPR120 modulerar PI3K-AKT och AMPK i vissa cellinjer. 23, 25 Därför hör de kända nedströmsmålen för GPR120 som kan vara involverade i modulering av mTOR-signalering till fyra signalvägar, nämligen Ras-Erk1 / 2, PI3K-AKT, p38-MAPK och AMPK. Vi odlade mBMMSC med hämmare av ovanstående signalvägar i närvaro av EPA. Endast förening C, en AMPK-hämmare, hade förmågan att markant sänka LC3-nivån (figurerna 4a och b), aktivera mTOR och öka fosforyleringen av S6K (figur 4c), vilket tydligt visade att AMPK / mTOR-signalvägen har en central roll i EPA-inducerad autofagi via GPR120. Det är anmärkningsvärt att hämning av autofagi med AMPK- och mTOR-hämmare och GPR120-knockdown med användning av shRNA inte fullständigt blockerade autofagi som behandlats med EPA, vilket antyder att EPA-inducerad autofagi inte uteslutande är beroende av AMPK-mTOR-medierad aktivering och att andra signalvägar kan delta i den anti-apoptotiska processen orsakad av EPA-behandling. Ytterligare studier behövs för att undersöka de alternativa mekanismerna för EPA-inducerad autofagi. Intressant nog har Kyu Lim et al. indikerade att DHA-inducerad autofagi var nödvändig för apoptotisk celldöd av cancerceller, vilket verkar motsäga våra resultat. 30 Dessa skillnader kan bero på flera faktorer. Först, medan vi använde mBMMSC, Lim et al. använde SiHa-celler. Signaleringsvägarna involverade i autofagi eller apoptosinducerad cancercelldöd är inte identiska i alla celltyper. För det andra kan GPR120-medierade cellförändringar skilja sig från p53-medierade förändringar. För det tredje kan induktion av autofagi variera baserat på cellodlingssystemet och miljön, så EPA eller DHA-inducerade autofagi-processer kan vara olika och utöva olika effekter på modulering av apoptos. Därför erhöll olika resultat erhållna av Kyu Lim et al. och vår studie antyder att potentiella terapeutiska strategier som är inriktade på autofagi kan variera beroende på de celltyper som är inblandade och ytterligare undersökning är nödvändig för att belysa den komplexa kopplingen mellan autofagi och apoptos.

Den sista frågan vi tog upp är om intaget av EPA eller AA påverkar de skadliga effekterna av Dex in vivo . GC-inducerad osteoporos är en utbredd klinisk komplikation av GC-terapi. Denna irreversibla skada på benbildande och -upptagande celler är väsentlig i patogenesen av osteoporos. Tidigare arbete har visat att GC-administration försämrade spridningen och inducerade apoptos av rBMMSC. 17 Som vi vet förlitar sig skeletttillväxten på både biosyntetiska och kataboliska processer, och autofagi är en katabolisk process som har en grundläggande del i vävnadshomeostas. I denna studie, i överensstämmelse med våra in vitro- data, ökade EPA LC3-nivån och skyddade celler från Dex-inducerad apoptos på ett dosberoende sätt, medan AA inte hade någon sådan effekt och till och med främjade apoptotisk celldöd inducerad av Dex (figur 5) . Det är värt att notera att TUG-891 också blockerade Dex-inducerad apoptos och inducerad LC3-nivå och effekten liknade den som framkallades av 100 μM EPA, vilket ytterligare bekräftar att GPR120 har en avgörande roll i EPA-inducerad autofagi och Dex- inducerad apoptos i mBMMSC både in vivo och in vitro .

Sammanfattningsvis är vår studie, så vitt vi vet, den första som visar att EPA, inte AA, terapi inducerar adaptiv autofagi i Dex-inducerad apoptos och upprätthåller den proliferativa förmågan via GPR120-medierad AMPK-mTOR signalväg (figur 6) . Sammantaget belyser denna studie betydelsen av EPA-inducerad autofagi i benhomeostas och Dex-inducerad apoptos, och detta fynd kan ha viktiga konsekvenser för att utveckla framtida strategier för att använda EPA i förebyggande och terapi av biverkningarna av långvarig GC-terapi .

Image

EPA, men inte AA, terapi inducerar adaptiv autofagi i Dex-inducerade apoptotiska mBMMSC och upprätthåller den proliferativa förmågan via GPR120-medierad AMPK-mTOR signalväg. Under omständigheten av Dex-inducerad apoptotisk celldöd är nedströmsmålen för GPR120 mycket involverade i anti-apoptos och autofagi-induktionsprocess när GPR120 aktiveras av EPA. I detalj aktiverar GPR120 Ras-Erk1 / 2-kaskad för att hämma Dex-inducerad apoptos och modulerar AMPK / mTOR för att inducera cellautofagi. Emellertid kan EPA-behandling ensam utan Dex inte inducera mycket autofagi, vilket indikerar effekten av EPA vid inducering av adaptiv autofagi när celler lider av Dex-inducerad apoptotisk celldöd

Bild i full storlek

Material och metoder

material

Det a-modifierade minimala väsentliga mediet köptes från Thermo Scientific (Waltham, MA, USA). Polystyrenkulturskålar erhölls från Costar (Corning, NY, USA), och fetalt bovint serum köptes från Gibco Life Technologies (Waltham, MA, USA). Anti-GPR120 (sc48203) och anti-GPR40 (sc32905) köptes från Santa Cruz (Dallas, TX, USA). Anti-p62 (ab56416), anti-mTOR (ab32028), anti-p-mTOR (ab109268), anti-S6K1 (ab32529), anti-p-S6k1 (ab5231), anti-Atg7 (ab133528) och anti-LC3B ( ab51520) köptes från Abcam (Cambridge, MA, USA). TUG-891 (4 - [(4-Fluoro-4'-metyl [1, 1'-bifenyl] -2-yl) metoxi] -bensenepropansyra) ( 4601-50) och U0126 (1144/25) köptes från R&D Systems (Minneapolis, MN, USA). LY294002 (L9908), SB203580 (S8307) och BafA1 (B1793) köptes från Sigma Chemical (St. Louis, MO, USA). Penicillin-streptomycin köptes från Solarbio (Peking, Kina). Det totala RNA-extraktionssatsen köptes från OMEGA (Norcross, GA, USA). PrimeScript RT-reagenspaketet och SYBR Premix Ex Taq köptes från TaKaRa (Dalian, Kina). Andra reagens var av högsta kommersiell kvalitet och köptes från Sigma Chemical.

Cellbehandling och kultur

BMMSC isolerades från Balb / c-möss som tidigare beskrivits, 31 och celler karakteriserades med användning av mesenkymala stamcellsminimala kriterier. 32 homogena BMMSC erhölls genom tre generationer. GC dexametason (Dex; Sigma-Aldrich, St. Louis, MO, USA), EPA (Cayman Chemical, Ann Arbor, MI, USA, 90110) och AA (Cayman Chemical, 10007268) upplöst i absolut etanol, RAPA (Tocris, Bristol, UK, 1292) upplöst i DMSO, och 3-MA (Sigma, St. Louis, MO, USA, M9281) upplöst i PBS sattes till mediet till slutkoncentrationer såsom beskrivits i varje experiment. Celler odlade till 60% sammanflytning byttes till serumfritt medium och kulturen fick expandera under 24 timmar innan man gav någon behandling. För behandling av Dex plus EPA eller AA inkuberades cellerna med vissa doser av Dex och EPA eller AA under 24 timmar. För EPA plus RAPA- eller 3-MA-behandling inkuberades celler med vissa doser av Dex och EPA i närvaro eller frånvaro av 100 nM RAPA och 5 mM 3-MA under 24 timmar. För Dex plus Baf- eller EPA-behandling behandlades celler i närvaro eller frånvaro av 100 μM EPA och 200 nM Bafilomycin Al (Baf) med eller utan 10 M Dex.

Detektion av autofagosomer genom transmissionselektronmikroskopi

Cellerna togs bort från plattorna med användning av 0, 25% trypsin trypsin-EDTA (Gibco Life Technologies) och fixerades med 2% paraformaldehyd / 2% glutaraldehyd (Sigma-Aldrich) i 0, 2 M natriumkakodylatbuffert (pH 7, 4; Sigma-Aldrich). Cellpellets efterfixerades med 1% (volym / volym) osminsyra (Sigma-Aldrich) i natriumkakodylatbuffert och färgades med 1% uranylacetat (Amresco, Solon, OH, USA). Efter uttorkning inbäddades pelletsen i Durcupan (Sigma-Aldrich). Ultratinsektioner (50 nm) framställdes med användning av ett Ultrotome Ultracut S (Leica Microsystems, Wetzlar, Tyskland) och bilder fångades med ett JEM-1230 transmissionselektronmikroskop (JEOL, Ltd., Tokyo, Japan).

MTT-analys

Cellviabilitet bestämdes genom 3- (4, 5-dimetyltiazol-2-yl) -2, 5-difenyltetrazoliumbromid (MTT) -analys. Efter behandling med Dexamethason i närvaro eller frånvaro med EPA eller AA under 24 timmar tvättades kulturer med PBS. MTT (0, 5 mg / ml) tillsattes sedan till varje brunn och blandningen inkuberades under 4 timmar vid 37 ° C. Odlingsmedium ersattes sedan med en lika stor volym DMSO för att lösa upp formazankristaller. Efter att blandningen skakades vid rumstemperatur under 30 minuter bestämdes absorbansen av varje brunn vid 550 nm.

TUNEL-analys

Apoptos i BMMSCs detekterades med användning av DeadEnd Fluorometric TUNEL System (Promega, Madison, WI, USA), som slutetiketterar DNA från de fragmenterade apoptotiska cellerna med användning av en modifierad TUNEL-färgning enligt tillverkarens instruktioner. I korthet fixerades prover med 4% metanolfri formaldehydlösning, sköljdes med PBS två gånger, och sedan märktes det fragmenterade DNA: t från de apoptotiska cellerna med användning av fluorescein-12-dUTP och täckte objektglas i DAPI för att färga kärnor. Prover analyserades omedelbart under ett fluorescensmikroskop med användning av en standard fluorescein-filteruppsättning (Olympus, Tokyo, Japan) för att se den gröna fluorescensen hos apoptotiska celler vid 520 nm och blå DAPI-färgade kärnor vid 460 nm.

Detektion av Caspase-3-aktivitet

Caspase-3 activity was measured spectrophotometrically via the detection of pNA cleavage by caspase-3-specific substrates. These experiments were completed using a Caspase-3 Assay Kit (Beyotime, Shanghai, China). After the cell lysates were incubated with Ac-DEVD-pNA for 2 h at 37 °C, the samples were read at 405 nm.

Annexin V/PI double staining

The number of apoptotic cells was determined by Annexin V/propidium iodide (PI) double staining. Cells were exposed to 1 μ M Dex in the presence or absence of EPA or AA for 24- h and then incubated with FITC-conjugated Annexin V in binding buffer (0.01M HEPES, 0.14M NaCl, and 2.5 mM CaCl2, pH 7.4) for 30 min at 37 °C in the dark. After incubation, the cells were washed and re-suspended in 200 ml PBS with 1% FCS and additionally incubated with 10 ml of 1 mg/ml PI solution. The Annexin V-positive cells were detected using a FACSCalibur flow cytometer (BD Biosciences, San Jose, USA), and the results were analyzed using CellQuest software (BD Biosciences). Annexin V-FITC conjugates were detected with the FL1 channel of the FACSCalibur machine. PI was read on the FL2 channel.

Immunfärgning

Cells were fixed in 4% paraformaldehyde for 15 min, permeabilized with methanol for 10 min, and incubated with primary antibodies anti-LC3B (1:100), phalloidine (1:200) antibodies overnight. On the following day, cells were incubated with a DyLight 594 and 488 secondary antibody (Abcam) for 1 h. After staining nuclei with DAPI (0.5 μ g/ml) for 5 min, the cells were analyzed under a FV1000 model confocal microscope (Olympus).

Western blot-analys

Cells were lysed in lysis buffer (50 mM Tris–HCl pH 7.4, containing 150 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 10 mg/ml leupeptin, 10 mg/ml pepstatin A, and 10 mg/ml aprotinin) on ice for 30 min. For western analysis, 10 μ g of total protein was resolved by 10% SDS-PAGE, and proteins were transferred onto a PVDF membrane. Anti-GPR120 (1:1000), anti-GPR40 (1:1000), anti-p62 (1:2000), anti-mTOR (1:5000), anti-p-mTOR (1:5000), anti-S6K1 (1:5000), anti-pS6k1 (1:2000), anti-Atg7 (1:3000), and anti-LC3B (1:1000) antibodies were used for immunoblotting. GAPDH användes som en lastkontroll. The horseradish peroxidase-conjugated secondary antibody was used at a 1:5000 dilution. Images were analyzed by Scion Image software.

Omvänd transkriptaspolymeras-kedjereaktion

Total RNA was purified from cells using Trizol (Invitrogen, Waltham, MA, USA). RT-PCR was performed, and results were analyzed as previously described. 33 All RT-PCR experiments were performed in triplicate, and the primers sequences were as follows: LC3 (Fwd) ATGCCGTCGGAGAAGACCTT, (Rvs) TTACACTGACAATTTCATCCCG, GPR120 (Fwd) CCAGTGTTGCTGGAGAAATC, (Rvs) TGATGCCTTGGTGATCTGTA; GPR40 (Fwd) AATGCTCCAATGTGGCTAGTTTC, (Rvs) GCCAGTGACCAGTGGGTTGA; Atg7 (Fwd) TCTGGGAAGCCATAAAGTCAGG, (Rvs) GCGAAGGTCAGGAGCAGAA; β-actin (Fwd) CTGGCACCACACCTTCTACA, (Rvs) GGTACGACCAGAGGCATACA.

Transfection of lentiviral vectors with shRNA for GPR120 and GPR40

The pGMLV-GFP-vshRNA-GPR120 was constructed (pGMLV, a shRNAi Vector, Shanghai Genomeditech Co. Ltd, Shanghai, China). In the present study, we constructed 3 vshRNA-GPR120 lentiviral vectors (pGMLV-GFP-shRNA-GPR120) and 3 vshRNA-GPR40 lentiviral vectors (pGMLV-GFP-shRNA-GPR40) to silence the expression of GPR120 and GPR40 in murine BMMSCs (BMMSCs-vshRNA-GPR120/40). Three shRNA-targeting sequences for GPR120 were as follows: #1, 5′-GCACCCACTTCCCTTTCTTCT-3′; #2, 5′-GCTCTTCTACGTGATGACAAT-3′; and #3, 5′-GGACCAGGAAATTCCGATTTG-3′. And three shRNA-targeting sequences for GPR40 were as follows: #1, 5′-CCCTGCCCGACTCAGTTTC-3′; #2, 5′-GGCAGCCCACATAGCAGAA-3; and #3, 5′-CCGGGCCCGTCTCAGTTTCTCCATTCTCGAGAATGGAGAAACTGAGACGGGCTTTTT-3′. Stably transfectantclones were characterized by RT-PCR, western blot, and immunoblotting.

Liten störande RNA-transfektion

siRNA oligonucleotides specific for Atg7 and the siRNA control were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Cells were seeded into a 60-mm dish which was then left for 24 h. A 2 ml aliquot of siRNA solution (10 mM) and 5 ml of Lipofectamine 2000 (Invitrogen) were each mixed with 100 ml of serum-free RPMI 1640 medium. They were incubated for 20 min at room temperature after combining the two mixtures, and this was then added to the cells that had been seeded on the dish. After 24 h, harvested cells were subjected to western blot analysis. Cells were also processed for cell viability and apoptosis analysis.

Animals and experimental procedures

A total of 40 healthy female Balb/c mice (4 months old; average weight, 22.1±1.4 g) obtained from the Laboratory Animal Centre of Fourth Military Medical University (Xi'an, China) were randomly divided into eight groups with five mice in each group. Randomization was performed using a random number table. The groups were divided as follows: (1) Dex, 3.5 mg/kg/d distilled water, Intraperitoneal Injection; (2–4) Dex+EPA (0.1, 0.4, 1 g/kg/day), intraperitoneal injection of Dex and oral gavage of EPA; 5-7) Dex+AA (0.1, 0.4, 1 g/kg/day), intraperitoneal injection of Dex and oral gavage of AA; (8) Dex+TUG-891, intraperitoneal injection of Dex and intra-bone marrow injection of TUG-891 (10 μ M/kg). Dex, EPA and AA treatments were administered daily and TUG-891 treatment was administered three times per week, for 8 weeks prior to sacrifice by cervical vertebra luxation. All experimental procedures were approved by the Institutional Ethics Review Board of Xijing Hospital (permission code 20110405-5).

Statistisk analys

Data were expressed as means±SD of multiple repeats of the same experiment ( n =5). The data for these measurements were analyzed by one-way analysis of variance with subsequent post hoc multiple comparisons by Dunnett's test. Statistically significant values were defined as P <0.05.

Kompletterande information

Bildfiler

  1. 1.

    Kompletterande figur 1

  2. 2.

    Kompletterande figur 2

  3. 3.

    Kompletterande figur 3

Word-dokument

  1. 1.

    Kompletterande figurlegender

Ordlista

EPA

Eikosapentaensyra

AA

arachidonic acid

Dex

dexamethasome

BMMSCs

bone marrow-derived mesenchymal stem cells

PUFA

polyunsaturated fatty acid

LC3

mikrotubuli-associerad protein lätt kedja 3

GPR120

G-protein coupled fatty acid receptor 120

Kompletterande information åtföljer detta dokument på Cell Death and Disease-webbplatsen (//www.nature.com/cddis)