En vanlig mutation i cog7-genen med en konsekvent fenotyp inklusive mikrocefali, adducerade tummar, tillväxtfördröjning, vsd och episoder av hypertermi | europeisk tidskrift för mänsklig genetik

En vanlig mutation i cog7-genen med en konsekvent fenotyp inklusive mikrocefali, adducerade tummar, tillväxtfördröjning, vsd och episoder av hypertermi | europeisk tidskrift för mänsklig genetik

Anonim
  • En rättelse till denna artikel publicerades den 21 juni 2007

Abstrakt

Vi beskriver de kliniska och biokemiska kännetecknen hos tre patienter från två olika familjer som har diagnostiserats med medfødt störning av glykosylering typ IIe på grund av en defekt i Conserved Oligomeric Golgi complex (COG) 7; en av de åtta underenheterna för COG. Syskon och ett obearbetat ensamstående barn med förnuftiga föräldrar uppvisade tillväxthämning, progressiv, svår mikrocefali, hypotoni, adduktade tummar, matningsproblem genom gastrointestinal pseudo-obstruktion, misslyckande med att blomstra, hjärtsjukdomar, skrynklig hud och episoder av extrem hypertermi. En kombinerad störning i biosyntesen av N- och O-kopplad glykosylering med hyposialylering detekterades. Western blot-analys visade en allvarlig minskning av COG5 och 7 underenheter av COG. En homozygot, intronisk splitsplatsmutation (c.169 + 4A> C) av COG7-genen identifierades i alla patienter. Fenotypen liknar den som tidigare beskrivits hos två patienter med nordafrikansk etnicitet med samma mutation, med undantag för bristen på skelettanomalier och endast en mild leverinvolvering hos våra patienter. Vi föreslår att man utför proteinglykosyleringsstudier och Western blot för de olika COG-subenheterna hos patienter med progressiv mikrocefali, tillväxtfördröjning, hypotoni, adducerade tummar och hjärtfel, särskilt i samband med hudanomalier eller episoder av hypertermi. Närvaron av den karakteristiska fenotypen kan motivera direkt DNA-analys.

Introduktion

Medfödda störningar av glykosylering (CDG) är en grupp av ärvda, multisystemstörningar orsakade av olika defekter i biosyntesen av glykokonjugat. De första patienterna beskrivs av Jaeken et al. 1 Sedan dess har många olika brister rapporterats. Den första defekten i en av underenheterna i det konserverade oligomera Golgi-komplexet (COG) identifierades 2004. 2

Detta multiproteinkomplex består av åtta underenheter, som krävs för att Golgi-systemet ska fungera korrekt och fungera. 3, 4 COG-systemets funktion inkluderar bevarande av Golgis integritet, proteintransport i Golgi och mellan endoplasmatisk retikulum (ER) och Golgi och dockning av glykosyleringsenzymer. 5

Defekter i COG-komplexet resulterar i flera brister i proteinglykosylering. 5, 6 De olika subenheterna bildar stabila subkomplex (COG2 tillsammans med 3 och 4 bildar lob A och COG5 tillsammans med 6 och 7 bildar lob B), där COG1 spelar en roll i förmedlingen av Golgi-komplexföreningen och COG8 hjälper de två subkomplexen att monteras i det kompletta COG-komplexet. 6

Underenheten COG7 visade sig vara kliniskt bristfällig i två syskon som lider av en generaliserad proteinglykosyleringsstörning som presenteras som en medfödd multisystemsjukdom. 2, 7 De visade en fenotyp av dysmorfa ansiktsdrag, mikrocefali, adduktade tummar, skelettanomalier, skrynklig hud, VSD, misslyckande med att blomstra och en allvarlig leversjukdom. Båda syskonen dog vid några veckors ålder. Biokemiska undersökningar visade ökad lysosomal enzymaktivitet i plasma och ett TIEF-mönster av typ 2-plasmaöverföring av isoelektrisk fokusering. O-glykosyleringsstudier genom isoelektrisk fokusering av plasma-apolipoprotein C-III (ApoC-III) visade ökade hyposialylerade isoformer. 7 Det visade sig att patienterna hade en homozygot punktmutation IVS 1 + 4A> C på ett skarvställe av COG7-genen. 2 Här rapporterar vi om tre nya patienter med en COG-defekt och en liknande fenotyp.

Patienter och metoder

patienter

Patient 1 föddes vid terminen som det andra kvinnliga barnet till friska, äkta föräldrar (första kusiner) av marockanskt ursprung. Graviditeten var komplicerad med oligohydramnion och placentainsufficiens. Vid födelsevikt var 2645 g (15: e centilen), längden 44 cm (<3: e centilen) och huvudomkretsen 31, 5 cm (<3: e centilen). Dysmorfa drag kännetecknades, inklusive uppslånande och korta palpebrala sprickor, en smal och platt panna med hypertrikos, en platt malär region, en bred och kort näsa, en slät filtrum, en liten mun, retrognathia, tjockt tandkött, låg uppsättning, bakre roterade öron och en kort hals med skrynklig hud (figur 1). Intermittent strabismus convergens noterades. Hon hade adducted tummar, överlappande, långa fingrar, en simian veck, sammandragningar av PIP och DIP lederna med ulnar avvikelse av händerna. Förlängningsrörelserna i höfterna och knäna och armens böjning / förlängning var något begränsad. Hon hade en minskad muskelmassa och muskelton med minskade djupa senreflexer. Den nyfödda behövde ytterligare sjukhusvistelse på grund av återkommande episoder av hypoglykemi, lunghypertoni och muskelhypotoni. Hon fick rörmatning för gastrointestinal pseudoobstruktion. Perioder med extrem hypertermi (> 41 ° C) av okänt ursprung observerades. Upprepad kraniell ultraljudundersökning visade hjärnatrofi med cerebellär atrofi, corpus callosum hypoplasia, breda cerebrala ventriklar och mega-cisterna magna. MR-hjärnan visade inte bevis för onormal gyration. Ultraljudsundersökning av muskler visade lägre ekodensitet jämförbar med bilden som ses i myopati. Skelettundersökningen, leverultraljud och oftalmologisk undersökning var normal. Ekokardiogrammet upptäckte en peri-membranös VSD med ASD II och tricuspidal insufficiens. BERA-utvärderingen bekräftade en sensori neural hörselnedsättning. På EEG fanns paroxysmala förändringar med skarpa flerfokuserade vågor och generaliserad frontal aktivitet (tabell 1).

Kliniska egenskaper hos patienter 1 ( a - d, h, j, m ) och 2 ( e - g, i, k, l ). Observera djupgående mikrocefali, platt panna, lågmässiga, dysplastiska öron, kort näsa, retrognati ( b, c, e, f, g, j ). ( h, i ) Skrynklig hud runt halsen och den bakre axelregionen. ( a, d och g ) adducerade tum- och perifera kontrakturer av DIP- och PIP-fogen med överlappande fingrar. ( c ) Observera adduerad tumme vid en ålder av 7 månader. ( k och m ) Onormal fettfördelning hos patienterna runt låren.

Bild i full storlek

Full storlek bord

Serologi för perinatala infektioner var negativ. Vid ytterligare screening hittades laboratorieundersökningar varken tecken på njur- eller leverdysfunktion eller endokrina eller metaboliska avvikelser. Under sjukdomsförloppet ökade ASAT- och ALAT-nivåerna gradvis upp till 890 U / l utan tecken på kolestas eller icterus. Serumaminosyrorna, acyl-karnitinprofilen, mycket långkedjiga fettsyror, 7-dehydrokolesterol och organiska syror i urin var också normala, med undantag för en förhöjd alaninnivå i serum (820 mmol / l, C: <450 mmol / l). TIEF var onormalt och visade ett typ 2-mönster. Nivåerna i blodkreatinkinas (CK) varierade mellan 144 och 760 U / l och upp till 4035 U / l i feberepisoder. Histologisk utvärdering av muskelbiopsin visade inga specifika avvikelser. ATP-produktion från pyruvatoxidation minskade, men aktiviteten hos andningskedjekomplexen I, II, IV och pyruvatdehydrogenaskomplexet var normal. Prometafas-karyotypanalys, Multiplex Ligation-beroende sondförstärkning för subelomera mikrodeletioner, mutationsanalys av LCAM1- locus och FISH-analys för Prader Willi-syndrom var normala.

Barnet hade en allvarlig tillväxtfördröjning och misslyckades med att frodas (vikt: 4060 g (

Patient 2 föddes vid termin som det tredje, manliga barnet till samma föräldrar. Vid födelsevikt var 2890 g (25: e centilen), längden 42 cm (<3: e centilen) och huvudomkretsen 33, 5 cm (10: e centilen). En smal och platt panna med en låg frontal hårlinje, korta palpebrala sprickor, hypertelorism, en plan malär region, en bred och kort näsa, en liten mun, retrognathia, lågsäta öron och en kort hals med skrynklig hud (figur 1) noterades. Han hade dragit tummarna, en simianveck, överlappande fingrar med sammandragningar av PIP-lederna och ulnarna avvikelse av händerna. Han hade en minskad muskelmassa och muskeltonus med minskade djupa senreflexer. Den nyfödda behövde ytterligare sjukhusinläggning sekundärt till svår pulmonell hypertoni och urosepsis på grund av obstruktiv uropati. CK-nivåer i blodet (normalt värde <200 U / l) varierade mellan 180 och 360 U / l och upp till 4000 U / l i feberepisoder. Han fick rörmatning för gastrointestinal pseudoobstruktion. Han hade också en allvarlig multisystemstörning, jämförbar med den hos sin äldre syster, inklusive mikrocefali, dysmorfa funktioner, hypotoni med perifera ledkontrakturer. Hjärnas ultraljud och MR visade hjärnatrofi med cerebellar atrofi och corpus callosum hypoplasia. Njur ultraljud visade hydronephrosis till vänster. Oftalmologisk undersökning var normal. Ekokardiografi upptäckte en peri-membranös VSD med ASD II (tabell 1).

Laboratorieundersökningar visade inga tecken på leverdysfunktion eller endokrina avvikelser. Serumaminosyrorna, acyl-karnitinprofilen, mycket långkedjiga fettsyror, 7-dehydrokolesterol och organiska syror i urin var också normala. CK-blodaktivitet förhöjdes upprepade gånger. Aktiviteten hos flera lysosomala enzymer (fukosidas, hexosaminidas och a -mannosidas) förhöjdes lätt i plasma. TIEF visade ett typ 2-mönster. Patienten dog vid 7 månaders ålder.

Patient 3 föddes vid terminen som det andra kvinnliga barnet till friska, äkta föräldrar (första kusiner) av marockanskt ursprung. Vid födelsevikt var 2300 g (<3: e centilen), längden 41 cm (<3: e centilen) och huvudomkretsen 31, 9 cm (<3: e centilen). Dysmorfa drag kännetecknades, inklusive uppskjutande och korta palpebrala sprickor, en smal och platt panna, en platt malär region, en bred och kort näsa, en slät filtrum, en liten mun, retrognati, tjockt tandkött, lågmässigt, bakåt roterad öron och en kort hals med skrynklig hud (figur 2). Hon hade tagit tummarna och överlappande, långa tår och fingrar. Axial ton ökades med tendens till opisthotonus. MR-hjärnan visade corpus callosum hypoplasia, breda cerebrala ventriklar och kortikalsubkortikal atrofi. Skelettundersökningen, leverultraljud och oftalmologisk undersökning var normal. Ekokardiogrammet var normalt. På EEG fanns det paroxysmala förändringar med skarpa spetsar med flera fokaler.

Kliniska egenskaper hos patient 3 som visar mikrocefali, platt panna, dysplastiska öron, kort näsa, retrognati och oregelbunden insättning av tårna.

Bild i full storlek

Vid en ålder av 3 veckor tilläts hon med extrem temperaturhöjning upp till 41 ° C utan bevisad infektion. Dessa avsnitt upprepades under det första året. Serologi för perinatala infektioner var negativ. Vid ytterligare screening av laboratorieundersökningar hittades varken tecken på njur- eller leverdysfunktion eller endokrina eller metaboliska avvikelser. Under sjukdomsförloppet ökades ASAT- och ALAT-nivåerna gradvis till 200–350 U / l med ökad leverstorlek till 3 cm under kostnadsmarginalen. Serumaminosyrorna, acyl-karnitinprofilen, mycket långkedjiga fettsyror, 7-dehydrokolesterol var normala och urinorganiska syror uppvisade ökad etylmalonsyrauria (fyra gånger förhöjd jämfört med kontroller). TIEF utfördes inte. CK-nivåer i blodet var alltid förhöjda och ökade under temperaturhöjningar, en gång upp till 45.900 U / l.

Histologisk utvärdering av muskelbiopsin visade inga specifika avvikelser. Andningskedjekomplex I, II, IV och pyruvatdehydrogenaskomplexet var normala. Prometafas-karyotypanalys, Multiplex Ligation-beroende sondförstärkning för subelomera mikrodeletioner var normal.

Barnet fortsatte att ha misslyckats med att frodas, ingen utvecklingsframsteg och episoder av extrem hypertermi upp till 42 ° C i samband med ökad ASAT, ALAT, LDH och CK. Hon dog i åldern av 8 månader.

TIEF och ApoC-III

Transferrin är ett N-glykosylerat protein. Flera isoformer förekommer i plasma, varvid tetrasialo-isoformen är den vanligaste. TIEF används som en screeningsmetod för detektering av N-glykosyleringsdefekter. ApoC-III är ett O-glykosylerat plasmaprotein med lika stora mängder disialo- och monosialo-isoformer utöver en mycket liten mängd asialo-ApoC-III. ApoC-III isofokusering används som en screeningsmetod för detektering av kärn-O-glykansk biosyntesdefekter av kärn-typ. Metoderna utfördes såsom beskrivits tidigare. 9, 10, 11

Western blot-analys av COG-underenheterna

Kontroll och patientens fibroblaster sköljdes två gånger med iskall PBS och lyserades på is i celllysbuffert (Tris-buffrad saltlösning kompletterad med 1% Triton X-100 (Sigma, Bornem, Belgien) med proteasinhibitor (Roche, Vilvoorde, Belgien) under 30 minuter. Olösligt material avlägsnades genom centrifugering vid 13 000 g under 15 minuter vid 4 ° C. Proteiner kvantifierades med användning av BCA-kit (Pierce, Polylab, Merksem, Belgien). Lika stora mängder protein blandades med reducerande 4 × prov laddningsbuffert (Invitrogen, Merelbeke, Belgien) innehållande 3% mercapto-etanol (Sigma), inkuberades vid 90 ° C i 5 minuter och separerades på 4–12% prefastade geler (Invitrogen). Proteiner överfördes på nitrocellulosamembran (Amersham, Diegem Och Belgien) och icke-specifika bindningsställen blockerades genom inkubation i TBS innehållande 0, 1% (volym / volym) Tween-20 (Sigma) och 5% (vikt / volym) icke-fett torkad mjölk. Ytterligare bearbetning av Western blot genomfördes genom applicering av lämplig primär- och pepparrotsperoxidas-konjugerad se kondary antikroppar i samma blockerande buffert. Blottarna utvecklades med användning av kemiluminiscens (Renaissance, Perkin Elmer, Zaventem, Belgien) och signalerna från de olika underenheterna kvantifierades med Image J-programvaran (//rsb.info.nih.gov/ij/).

Molekylär genetisk / sekvensanalys

Mutationsanalys på indexpatienterna 1 och 3 utfördes på cDNA för generna COG2 , COG3 , COG4 , COG5 , COG6 , COG7 och på genomiskt DNA för COG1 och COG8 . Totalt RNA isolerades från patientens fibroblaster och en normal kontroll med användning av RNeasy Kit (QIAGEN, Venlo, Nederländerna). CDNA framställdes sedan med oligo-dT-priming (Amersham) och Superscript III RNase (Invitrogen). Primrar konstruerades för att förstärka hela cDNA, till exempel COG7-primrar framåt (CCGGAGCCAACTCTTAAGTTC) och bakåt (GAAGAGATTCGGCAGCAAGT). Andra primersekvenser är tillgängliga på begäran.

Ett 0, 4 mikroliter cDNA-prov användes i en total volym av 50 mikroliter med DNA-polymerasblandning och buffert 1 i det expanderande långa mall-PCR-systemet (Roche). Amplifieringsbetingelserna var 2 min vid 95 ° C, 10 cykler på 10 s vid 95 ° C, 30 s vid 65 ° C (−1 ° C varje cykel) och 2 min vid 68 ° C följt av 25 cykler på 10 s vid 95 ° C, 30 s vid 55 ° C och 2 min vid 68 ° C.

Sekvensanalys av cDNA utfördes i sju delar med överlappande ändar med användning av Big Dye Terminator v3.1 cykelsekvenssats på ABI 3100 Avant (Applied Biosystems, Nieuwerkerk a / d Ijsel, Nederländerna).

För att bekräfta närvaron av COG7- mutationen amplifierades exon 1 och den första delen av intron 1 i det genomiska DNA med användning av följande primrar: CCGGAGCCAACTCTTAAGTTC (F) och AGGGTATTTGCTGTCCATGC (R). Amplifieringsbetingelserna var 5 minuter vid 95 ° C, 20 cykler på 30 s vid 95 ° C, 30 s vid 65 ° C (−0, 5 ° C per cykel) och 30 s vid 72 ° C följt av 20 cykler på 30 s vid 95 ° C, 30 s vid 55 ° C och 30 s vid 72 ° C. Dessa betingelser användes också för amplifiering av exonerna och de flankerande introniska regionerna av COG1 och COG8 . DNA isolerades från fibroblaster från patienter 1 och 3 och från leukocyter för patient 2.

Haplotype-analys

Polymorfa markörer (D16S412, D16S403, D16S417, D16S481), som sträcker sig över ett område på 800 kb runt COG7, användes för att belysa familjemedlemmarnas haplotyp och en medlem av den första beskrivna familjen med en COG7-defekt. 2 PCR-produkten (0, 1 μl ) blandades med 0, 1 μl Gene Scan 500 ROX-standardstorlek (Applied Biosystem) och 10 mikroliter Hi-Di-formamid (Applied Biosystems) och placerades i 3 minuter på 95 ° C. Analys utfördes med Gene Scan 3.7 (Applied Biosystems).

Resultat

Transferrin isoelektrisk fokusering

Plasmaprover från patienterna ( Patienterna 1 respektive 2 ) visade upprepade gånger ett onormalt transferrin isofokuseringsmönster med en minskning av tetrasialotransferrinisoformerna (23 och 30%, kontroller: 52-70%), men ökning av hypoglykosylerade transferrinisoformer (figur 3 ) i båda syskon; asialo: 12 och 3%, kontroller: <3%; monosialo: 12 och 8%, kontroller <4%; disialo: båda 17%, kontroller: <3–11%, trisialo: 24 och 26%, kontroller: 4–17%). En proteinpolymorfism som orsak till en onormal transferrin isofokuseringsprofil utesluts genom sialidas-matsmältning. Närvaron av sialidas i blodproverna från båda patienterna (antingen på grund av vissa infektioner eller felaktig blodprovtagning / -hantering) utesluts genom enzymaktivitetsmätning i serum, som inte visade någon aktivitet. Patienterna klassificerades som att de hade en oidentifierad CDG typ II, vilket tyder på att defekten är belägen vid behandlingen av N-glykaner lokaliserade i Golgi. Ingen analys utfördes i patient 3 .

( a ) Isoelektrisk fokusering av ApoC-III och transferrin hos patienter 1 och 2 jämfört med friska kontroller, till mönstret i CDG typ Ia, och resultaten från barnet beskrivet av Freeze et al (COG7; Wu et al 2 och Spaapen et al. al 7 ) bär samma genetiska och biokemiska defekt, som visar hypoglykosylering av både mucinkärnan O-glykaner och N-glykaner. ( b ) COG-subenhetsanalys i patient 1 visar COG7-brist med sekundär brist på tillhörande lob B-subenheter.

Bild i full storlek

ApoC-III isoelektrisk fokusering

Plasmaprover från de två patienterna som analyserades visade upprepade gånger en onormal ApoC-III isofokuseringsprofil (figur 2). Patienterna 1 respektive 2 hade det karakteristiska mönstret för ökade mängder av ApoC-III 0 (17 och 12%, kontroller: 0–8%), normala mängder av ApoC-III 1 (57 och 66%, kontroller: 34– 58%) och minskade mängder av ApoC-III 2 (26 och 22%, kontroller: 40–62%). ApoC-III-isoformfördelningen var jämförbar med en av patienterna som beskrivs med en CDG-IIe-defekt (COG7 i figur 2. 2, 7, 10 )

Western blot-analys av COG-underenheterna

Jämfört med kontroller hittades en signifikant minskning av stabilitetsnivåerna för loben B-subenheter hos patienterna 1 och 2 . Semikantitativ analys av de reducerade subenheterna visade 94% minskning för COG5, 73% minskning för COG6, 95% minskning för COG7 och 71% minskning för COG8 (figur 3b). Dessa resultat är i överensstämmelse med resultaten från tidigare experiment i COG7-bristfälliga däggdjursceller.

Genetisk analys

Genetisk analys av COG7 utfördes i patienter 1 och 2 baserat på de biokemiska fynden och i patient 3 baserat på den karakteristiska fenotypen. Mutationsanalys på cDNA utfört på patienter 1 och 3 avslöjade åtminstone två olika transkript, ett med en 19 baspardeletion och en med en 83 basparinsättning. Sekvensanalys av exon 1 och den flankerande intronsekvensen på genomiskt DNA visade en homozygot intronisk splitsnings-mutation c.169 + 4A> C. Denna mutation stör störningsgivarplatsen och aktiverar minst två olika kryptiska splitsningsplatser, vilket leder till olika transkript. Samma mutation hittades i patient 2 (syskon till patient 1) och hos patient 3 . Föräldrarna och ett friskt syskon av patienterna 1 och 2 var heterozygota för c.169 + 4 A> C-mutationen. Mutationsanalys av de andra underenheterna av COG-komplexet hos patienterna 1 och 3, detekterade inga andra patogena mutationer.

Haplotyping med fyra polymorfa markörer i närheten av COG7 visade att alla tre drabbade barnen var homozygota för samma haplotyp på 680 kb runt COG7- genen (polymorfa markörer D16S481 och D16S417). Den tidigare beskrivna COG7-patienten 5 (tabell 1) från studien av Wu et al 2 hade samma mutation och samma haplotyp som de nuvarande patienterna. Denna patient är homozygot för samma haplotyp på 800 kb med patienterna 1 och 2 kring COG7- genen (alla fyra polymorfa markörer).

Diskussion

Patienter med ett serumöverföring IEF typ 2-mönster kan delas upp i undergrupper, nämligen med normala och onormala ApoC-III IEF-profiler. 10 Hos våra initiala patienter hittades ett typ 2-transferrinmönster tillsammans med en onormal ApoC-III 0- profil. Hittills har alla patienter med COG-brist samma kombination av IEF-profiler. Upptäckten av det karakteristiska biokemiska "mönstret" genom den inledande metaboliska screeningen kan vara mycket viktigt vid diagnostik av patienter med misstänkt defekt av COG-komplexet.

Här rapporterar vi om ytterligare tre patienter med en defekt i COG7-underenheten i COG-komplexet. Spännande, bär patienterna samma homozygot mutation c.169 + 4 A> C som de som beskrivits tidigare. 2 C.169 + 4 A> C-punktmutationen försämrar skarvningen på den kanoniska platsen och tillåter användning av ett kryptiskt, bevarat alternativt skarvningsställe nära den första exon / introngränsen. Man kan överväga möjligheten till en mutation hot spot som den underliggande etiologin för den vanliga mutationen. Inga kända trinukleotid- eller tetranukleotidmotiv är placerade på mutationsstället, vilket har visat sig öka frekvensen för denna specifika mutation. 12

Enligt vår utvidgade familjehistoria är medlemmarna i de tre familjerna som bär COG7- mutationer inte heller släkt. Intressant nog flyttade alla familjer från Afrika; patienterna som beskrivs av Wu et al 2 härstammar från Tunisien, medan våra patienter är av marockansk härkomst. Mutationen presenteras inom samma haplotyp i alla de tre, hittills beskrivna familjerna, bekräftade genom haplotypanalys med markörer som sträcker sig över 680 kb runt COG7- genen. De vanliga etniska och genetiska förfäderna till stora undergrupper av tunisisk och marockansk befolkning kan ge en förklaring till de överlappande haplotyperna och patienterna kan ha samma förfädermutation. 13 Denna specifika mutation kan vara en vanlig nordafrikansk mutation, men detta behöver ytterligare undersökningar.

Fenotypiska egenskaper hos de två patienterna är progressiv mikrocefali, karakteristiska ansiktsdrag, intrauterin tillväxtfördröjning, matningssvårigheter på grund av tarmens pseudoobstruktion med misslyckande med att blomstra, uttalad medfödd hypotoni med adduktade tummar, hjärtsjukdomar, skrynklig hud och episoder av svår hypertermi. Kombinationen av djup mikrocefali, upptagna tummar, hjärtfel och idiopatisk hypertermi är ganska unik och rapporteras sällan hos barn. Neonatal hypotoni, distala fingerkontraktioner / adducerade tummar och svår mikrocefali har beskrivits hos patienter med det adducerade tummsyndromet (MIM 201550), som verkar vara genetiskt heterogent. Våra patienter har många överlappande funktioner med detta syndrom, inklusive neonatal hypotoni, fingeravvikelser, mikrocefali, öronomalier, telecanthus, platt panna, kramper och tidig död. De flesta patienter har emellertid inga hjärtfel, men kraniosynostos eller medfödda hjärna missbildningar med kontrakturer i de stora lederna, som inte fanns i de två syskon. 14, 15 En liknande klinisk fenotyp observeras hos barn med en kromosomal mikrodeletion 1p36.3, inklusive hypotoni, kortfosterskada hos nyfödda, tillväxtfördröjning, mikrocefali, adducerade tummar, öronavvikelser, korta palpebrala sprickor och mikrocefali. 16 Kromosomanalyser med hög upplösning och MLPA-studier för möjliga subterminala mikrodeletioner var dock normala hos våra patienter.

Att jämföra de kliniska funktionerna hos syskon med de tidigare beskrivna med en COG-brist, har vi funnit några överlappande funktioner hos barn som bär mutationer i COG1- genen, inklusive multisysteminvolvering, hypotoni, tillväxtfördröjning, kort statur, mikrocefali, dysmorfa funktioner och lever involvering 8 (tabell 1). Ett något liknande kliniskt spektrum av symtom har observerats hos en patient med COG8-brist, inklusive hypotoni, tillväxt och utvecklingsfördröjning, kort statur, strabismus och ataxi, jämförbar med fenotypen, observerad hos barn med mitokondriella störningar (tabell 1). 17, 18 Barnen som beskrivs med COG1 och med COG8-brist hade emellertid en betydligt mildare klinisk presentation. Proband med COG1- mutation hade förknippad ventrikulär hypertrofi / hjärtdysfunktion och en kort rhizomelisk statur som inte heller var närvarande hos våra patienter.

När det gäller de patienter som beskrivs med samma COG7- mutation, bekräftade vi en konsekvent fenotyp. Den mest uttalade skillnaden jämfört med våra patienter var förekomsten av skelett avvikelser hos de tidigare rapporterade patienterna och ett mindre uttalat leverinvolvering hos våra patienter. Våra patienter hade å andra sidan episoder av hypoglykemi och allvarliga återkommande episoder med hypertermi. Vi föreslår att de få observerade skillnaderna är jämförbara med den intra-familjala variationen som ses vid olika metaboliska störningar.

Vår tredje patient diagnostiserades utan någon tidigare metabolisk screening, helt enkelt baserat på den karakteristiska kliniska presentationen, särskilt episoderna med extrem hypertermi. Närvaron av den suggestiva fenotypen kan därför motivera direkt DNA-analys och kan vara tillräcklig för att diagnostisera detta nya genetiska syndrom.