Karnosin dämpar utvecklingen av både typ 2-diabetes och diabetisk nefropati hos btbr ob / ob-möss | vetenskapliga rapporter

Karnosin dämpar utvecklingen av både typ 2-diabetes och diabetisk nefropati hos btbr ob / ob-möss | vetenskapliga rapporter

Anonim

ämnen

  • Kronisk njursjukdom
  • Diabetes komplikationer
  • Experimentella modeller av sjukdom
  • Genetisk predisposition för sjukdom
  • Fetma

Abstrakt

Vi har tidigare visat att polymorfismer i carnosinase-1-genen (CNDP1) bestämmer risken för nefropati hos patienter med typ 2-diabetiker. Karnosin, substratet för enzymet som kodas av denna gen, anses renoprotektivt och kan eventuellt användas för att behandla diabetisk nefropati (DN). I denna studie undersökte vi effekten av karnosinbehandling in vivo i BTBR (Black and Tan, BRachyuric) ob / ob- möss, en typ 2-diabetesmodell som utvecklar en fenotyp som liknar avancerad human DN. Behandling av BTBR- ob / ob- möss med 4 mM karnosin under 18 veckor minskade plasmaglukos och HbA1c, samtidigt med förhöjda insulin- och C-peptidnivåer. Även albuminuri och njurvikter minskades i karnosinbehandlade möss, som visade mindre glomerulär hypertrofi på grund av en minskning av ytan på Bowmans kapsel och utrymme. Karnosinbehandling återställde den glomerulära ultrastrukturen utan att påverka podocytantalet, resulterade i en modifierad molekylkomposition av den expanderade mesangialmatrisen och ledde till bildandet av karnosin-akroleinaddukter. Våra resultat visar att behandling med karnosin förbättrar glukosmetabolismen, albuminuri och patologi hos BTBR ob / ob- möss. Följaktligen kan karnosin vara en ny terapeutisk strategi för att behandla patienter med DN och / eller användas för att förhindra DN hos patienter med diabetes.

Introduktion

Den globala förekomsten av typ 2-diabetes ökar stadigt och har nått epidemiska proportioner 1 . Patienter med typ 2-diabetes har 40% risk för att utveckla diabetisk nefropati (DN), den främsta orsaken till njursjukdom i slutstadiet (ESRD) i den västra världen 2 . Trots multifaktoriellt ingripande fördröjer nuvarande terapiförlopp endast utvecklingen av DN, men förhindrar inte ESRD 3 . Faktum är att patienter med typ 2-diabetes som genomgår modern behandling kan fortfarande utvecklas till ESRD, medan andra aldrig kommer att utveckla DN oberoende av metabolisk kontroll 4 . Den här dikotomin tvivlar på vår nuvarande förståelse av patofysiologin hos DN och belyser vikten av genetiska faktorer som predisponerar för DN 5 .

Ett växande bevismaterial indikerar ett genetiskt bidrag från CNDP1- genen till utvecklingen av DN 6, 7 . Denna gen kodar för karnosinas-1, ett cirkulerande enzym som bryter ned dipeptidkarnosinet. Vi har tidigare visat att patienter med genpolymorfismer associerade med lägre serumkarnosinasnivåer är mindre mottagliga för utvecklingen av nefropati. Detta indikerar en skyddande roll för karnosin på njurarna. Karnosin uppvisar potenta anti-glykationsegenskaper och visade sig skydda humana podocyter och mesangialceller under hyperglykemiska förhållanden 6, 8 . Studier in vivo visade positiva effekter av karnosin på metabolisk kontroll i gnagarmodeller av diabetes 9, 10 . Ändå kunde dessa studier inte visa förebyggande av diabetisk nefropati, eftersom modellerna som används inte återspeglar avancerade stadier av humant DN 11 . Dessutom är användningen av streptozotocin-råttor (STZ) tvivelaktig eftersom CNDP1-föreningen med DN är begränsad till typ 2-diabetes 6 .

I denna studie använde vi BTBR (Black and Tan, BRachyuric) ob / ob (leptin-brist) musmodell för att studera effekten av karnosintillskott på histopatologiska och molekylära parametrar av DN. Den snabba början och reversibiliteten av morfologiskt avancerad DN gör denna modell unikt för interventionsstudier 11, 12 . BTBR-musstammen är hyperinsulinemisk och disponerad för fetma 13, 14 . Mutanta möss som saknar hormonet leptin ( ob / ob ) är milt hyperglykemiska och utvecklar uttalad fetma 15 . När BTBR-bakgrunden kombineras med ob / ob- mutationen, är möss insulinresistenta och hyperglykemiska och utvecklar snabbt en fenotyp som liknar avancerad humant DN 11, 13 . Vi undersökte om karnosintillskott kan påverka utvecklingen och utvecklingen av den avancerade njurfenotypen i BTBR ob / ob- möss.

Resultat

Karnosin förbättrar diabetes hos BTBR- ob / ob- möss

BTBR- ob / ob- musmodellen (fig. 1A) har beskrivits som en modell för avancerad fetma-relaterad diabetes på grund av brist på hormonet leptin. Vi bedömde förloppet av diabetes under 18 veckor i tre grupper ( wt / ob, ob / ob , carnosine-supplemented ob / ob ). Tre ob / ob- möss dog innan studiens slut, sannolikt orsakade av deras diabetiska fenotyp. Av dessa möss var två obehandlade och en behandlades med karnosin. Som förväntat utvecklade homozygota möss fetma och ökade i kroppsvikt i enlighet därmed under hela observationsperioden (fig. 1B). Däremot ökade heterozygota möss i kroppsvikt enligt förväntningar på icke-feta friska möss. Som surrogat för osmotisk diurese bedömdes det dagliga vattenintaget. Drickvolymen var mycket högre hos homozygota möss än hos heterozygota möss (Fig. 1C). Intressant nog visade karnosin-administrerade ob / ob- möss ett signifikant lägre dagligt vattenintag mot slutet av försöksperioden jämfört med ob / ob- kontrollmöss ( P <0, 001). FPG höjdes signifikant i BTBR- ob / ob- möss jämfört med wt / ob- möss. Karnosinbehandling resulterade i markant reducerad FPG (fig. 1D , P <0, 01) jämfört med ob / ob- möss och slumpmässig glykemi uppmätt före avlivning ( P <0, 01) (fig. 1E). Förbättring av glukosmetabolismen med karnosin bekräftades också genom bestämning av glykerat hemoglobin (HbA1c) (fig. 1F). I början av observationen visade ob / ob- möss redan signifikant ökad HbA1c jämfört med möss med wt / ob ( P <0, 0001). Baslinjen HbA1c före behandling skilde sig inte mellan båda diabetiska grupperna. Men efter 18 veckor med karnosinadministration observerade vi en signifikant minskning av HbA1c i behandlingsgruppen jämfört med ob / ob- kontrollmöss ( P <0, 05). Eftersom dyslipidemi är förknippad med diabetes och nödvändig för diagnos av metaboliskt syndrom, mätte vi kolesterol i slutet av experimentet. Serumkolesterol var signifikant högre hos homozygota möss ( P <0, 01) (fig. 1G) men påverkades inte av karnosinadministrering. Som en känslig markör för inflammation bestämdes C-reaktivt protein (CRP) i serum (fig. 1H). Homozygota möss hade signifikant högre CRP jämfört med wt / ob- möss ( P <0, 05). Carnosine-administration hade ingen effekt på CRP.

( A ) Representativ bild av en 24 veckor gammal BTBR ob / ob- mus. ( B ) Kroppsvikt ökade hos ob / ob- möss, oberoende av karnosinbehandling. ( C ) Dagligt vattenintag ökades hos ob / ob- möss relativt vatt / ob- möss och dämpades i karnosin-administrerade djur. ( D ) Veckobestämning av fastande plasmaglukos (FPG) indikerade manifest hyperglykemi hos ob / ob- möss, vilket reducerades i karnosinbehandlade djur under hela observationsperioden. ( E ) Slumpmässig glykemi (mätt före perfusion) var signifikant lägre i karnosin-administrerade ob / ob- möss jämfört med ob / ob- kontroller. ( F ) Vid ålder av vecka 24 (18 veckors behandling) höjdes HbA1c-nivåerna av ob / ob- djur och minskades signifikant i karnosinbehandlade möss. ( G och H ) Serumkolesterol och C-reaktivt protein (CRP) (vid 24 års ålder) förhöjdes hos ob / ob- möss och påverkades inte av karnosin. Data representerar betyder ± SEM. * P <0, 05, ** P <0, 01, *** P <0, 001 jämfört med möss med ob / ob . # P <0, 05, ## P <0, 01, ### P <0, 001, #### P <0, 0001 jämfört med vikt / ob- möss. Bil: karnosin.

Bild i full storlek

Karnosin stimulerar insulin, men inte glukagonutsöndring

Som en nyckelfaktor för alla typer av diabetes bestämde vi insulinnivåer i serum som erhölls i slutet av observationsperioden (Fig. 2A). Vi upptäckte förhöjd seruminsulin hos ob / ob- möss jämfört med heterozygota kontroller. Intressant nog höjde karnosinbehandlingen ytterligare insulinnivåer mer än tvåfaldigt ( P <0, 01), vilket möjligen svarade för den förbättrade metaboliska kontrollen. Vi fann faktiskt en signifikant negativ korrelation av seruminsulin och glykemi inom den karnosin-administrerade ob / ob- gruppen ( P <0, 05) (Fig. 2B). Korrelationen mellan insulin och HbA1c nådde inte statistisk signifikans. Ingen korrelation hittades mellan insulin och ACR. Den karnosininducerade ökningen av seruminsulin parallellt med en signifikant höjning av serum C-peptidnivåer jämfört med ob / ob- kontrollgruppen ( P <0, 001) (Fig. 2C). Glukagonnivåerna förhöjdes i båda ob / ob- grupperna ( P <0, 05) (Fig. 2D), men karnosinbehandlingen påverkade emellertid inte dessa hormonnivåer.

( A ) Insulinnivåer i serum (vid vecka 24 i åldern) indikerade hyperinsulinemi hos ob / ob- möss, vilket ytterligare ökades med mer än två gånger i karnosinbehandlade möss. ( B ) Glykemi korrelerade negativt med seruminsulinnivåer i karnosin-administrerade möss. ( C ) C-peptidnivåer var signifikant högre i karnosinbehandlade möss jämfört med obehandlade ob / ob- möss. ( D ) Glukagonnivåerna förhöjdes i båda ob / ob- grupperna, men påverkades inte av karnosinbehandling. ** P <0, 01, *** P <0, 001 jämfört med ob / ob- möss. # P <0, 05, ## P <0, 01 jämfört med wt / ob- möss. Bil: karnosin.

Bild i full storlek

Karnosin dämpar albuminuri och glomerulär hypertrofi

Vi bestämde albumin / kreatinin-förhållandet (ACR) för att bedöma utvecklingen av diabetisk nefropati (fig. 3A). Vid vecka 10 observerades inga signifikanta skillnader i ACR mellan behandlade och icke-behandlade ob / ob- möss, medan ACR vid slutet av observationsperioden minskade anmärkningsvärt i karnosinbehandlade möss jämfört med diabetiska kontrollmöss ( P <0, 0001 ), som utvecklade en 50-faldig ökning av ACR. För att bedöma njurhypertrofi vägdes njurarna efter offret. Den absoluta njurvikten var signifikant högre hos ob / ob- möss jämfört med mus / ob- möss ( P <0, 0001) (Fig. 3B). På grund av de markant lägre kroppsvikt hos heterozygota djur skilde sig de relativa njurvikterna inte signifikant från ob / ob- möss (fig. 3C). Karnosinbehandling resulterade i signifikant minskad absolut och relativ njurvikt jämfört med ob / ob- kontrollmöss ( P <0, 05). Njurfunktionen utvärderades med serumkreatinin (fig. 3D) och blodureakväve (BUN) (fig. 3E) vid slutet av experimentet. I själva verket hittades de högsta serumkreatininnivåerna i heterozygota möss, vilket skilde sig väsentligt från de lägsta nivåerna som hittades i karnosin-kompletterade möss ( P <0, 01). Denna skillnad kan förklaras av det högre muskelinnehållet i icke-diabetiska möss och är i linje med andra studier 11 . De högre serumkreatininnivåerna i wt / ob är i linje med tidigare studier 11 och kan tillskrivas ökad kreatininproduktion hos wt / ob- möss på grund av en högre muskelmassa och glomerulär hyperfiltrering som förekommer i ob / ob- möss som redan beskrivits 16, 17 och som indikeras av utvidgningen av Bowmans utrymme. Ingen av grupperna visade kreatininnivåer som tyder på njursvikt. Inga signifikanta skillnader mellan behandlade och icke-behandlade homozygota möss observerades med avseende på både serumkreatinin och BUN.

( A ) Carnosine-administration under 18 veckor minskade signifikant ACR vid vecka 24 med mer än två gånger jämfört med ob / ob- kontrollerna. ( B ) I slutet av experimentet ökades njurvikten (genomsnittet av båda njurarna) signifikant hos ob / ob- möss, vilket dämpades i karnosinbehandlade möss. ( B och C ) I slutet av experimentet ökades den absoluta njurvikten (genomsnittet för båda njurarna) signifikant hos ob / ob- möss. Karnosinbehandling resulterade i både minskade absoluta och relativa njurvikter. ( D och E ) Serumkreatinin och blodureakväve (BUN) bestämdes i slutet av experimentet. De högsta serumnivåerna av kreatinin hittades i heterozygota möss, vilket var signifikant olika från de lägsta nivåerna som hittades i karnosin-kompletterade homozygota möss. Inga skillnader observerades med avseende på BUN mellan någon av grupperna. Data representerar betyder ± SEM. * P <0, 05, **** P <0, 0001 jämfört med ob / ob- möss. ## P <0.01, #### P <0.0001 jämfört med möss med vikt / ob . Bil: karnosin.

Bild i full storlek

På den histologiska nivån kvantifierades förändringar i ytarea hos glomeruli för alla grupper eftersom DN resulterar i distinkta strukturella förändringar av njurarna (Fig. 4). BTBR- ob / ob- möss visade en signifikant förstoring av Bowmans kapsel ( P <0, 0001) (Fig. 4B), Bowmans rymd ( P <0, 0001) (Fig. 4C) och glomerulär tuft ( P <0, 0001) (Fig. 4D) jämfört till sina heterozygota kullkamrater. Carnosine-administration minskade signifikant utvidgningen av Bowmans kapsel ( P <0, 05) och utrymme ( P <0, 05). Ytarean för den glomerulära tuft var också lägre hos karnosin-administrerade möss; emellertid nådde detta inte statistisk betydelse. Dessutom korrelerade utvidgningen av Bowmans utrymme positivt med glykemi ( P <0, 0001), HbA1c ( P = 0, 001) och ACR ( P <0, 001) (Fig. 4E).

( A ) Representativa bilder av glomeruli (PAS-färgade sektioner) från möss med wt / ob, ob / ob och ob / ob- karnosin. ( B, C och D ) Ytområdena av Bowmans kapsel ( B ), Bowmans utrymme ( C ) och glomerulär tuft ( D ) ökades i ob / ob- möss, medan karnosinbehandlade möss visade en minskning av området för Bowmans kapsel och rymden. ( E ) Ytarea i Bowmans utrymme korrelerade positivt med glycemia, HbA1c och albumin-creatinin-förhållande (ACR). Data representerar betyder ± SEM. * P <0, 05 jämfört med möss med ob / ob . #### P <0, 0001 jämfört med möss med vikt / ob . Bil: karnosin.

Bild i full storlek

Carnosine återställer glomerulär ultrastruktur utan att påverka podocytnumret

Eftersom podocyter är kritiska celler för upprätthållande av selektiviteten hos den glomerulära filtreringsbarriären och blir mindre i antal med början av albuminuri i DN, utvärderade vi podocytantalet med WT1-immunfärgning (fig. 5A). BTBR- ob / ob- möss visade en minskning av WT1-positiva podocyter jämfört med deras heterozygota kullkamrater ( P <0, 001), vilket inte förhindrades genom behandling med karnosin (data visas inte). Immunfarvning för klyvt caspase-3 visade en signifikant ökning av apoptotiska glomerulära celler i båda ob / ob- grupperna jämfört med wt / ob (data visas inte).

( A ) Representativa bilder av glomeruli immunfärgade för WT1 (och försänkta med hematoxylin) för att visualisera podocyter (bruna) i wt / ob, ob / ob och ob / ob karnosin-kompletterade möss. Podocytförlust observerad hos ob / ob- möss förhindrades inte genom karnosinbehandling (kvantifiering nu visad). ( B ) Representativa elektronmikrografier (30.000x) av glomeruli från ob / ob och ob / ob karnosin-kompletterade möss. Obehandlade möss visade fullständig podocyteffekt (stjärnor), GBM-förtjockning och svullnad av glomerulära endotelceller med förlust av fenestrae (dubbla pilar). Karnosinbehandlade möss uppvisade en normal kapillärväggstruktur med intakta podocytfotprocesser, slitsmembran (pilar) och endoteliala fenestrae (pilspetsar). FP: fotprocess; GBM: glomerulär källarmembran; USA: urinutrymme; CL: kapillärlumen; Bil: karnosin.

Bild i full storlek

På ultrastrukturnivå (fig. 5B), visade alla kontroll- ob / ob- möss global tillbakadragning och utmattning av podocyter i deras glomeruli. Dessutom observerades förtjockning av GBM. Glomerulära endotelceller från dessa möss hade förlorat de flesta av sina fenestrae och hade utvecklat ett svullet, vakuoliserat utseende. Ultrastrukturen hos de glomerulära väggarna från möss behandlade möss visade ingen av dessa ultrastrukturella avvikelser. Deras podocyter hade normala slitsporer, podocytförlängningar och fenestrerade endotelceller.

Mesangial expansion är en nyckelfunktion i människans DN. Vi utvärderade mesangialmatrisutvidgning med PAS-färgade sektioner. Njurvävnad graderades blindt på en skala från I till IV beroende på mängden mesangial matris och glomerulär skleros. BTBR- wt / ob- möss visade en genomsnittlig karaktär mellan I (0–10% mesangialmatris) och II (10–50%). Både BTBR ob / ob- obehandlade och karnosinbehandlade möss visade en medelgrad mellan II (10–50%) och III (> 50%). Som förväntat var den beräknade genomsnittliga mesangiala matrisutvidgningen högre hos homozygota djur jämfört med deras heterozygota kullkamrater ( P <0, 05). Karnosinbehandling förhindrade emellertid inte denna ökning av glomerulär skleros (data visas inte).

Karnosin förändrar den molekylära sammansättningen av mesangial skleros

Eftersom ökade nivåer av flera extracellulära matrisproteiner (ECM) -proteiner observeras i tidiga och sena stadier av DN, undersökte vi den molekylära sammansättningen av de mesangiala lesionerna genom kvantitativ immungäring. Faktiskt avslöjade immunfärgning för fibronektin att de glomerulära lesionerna innehöll en väsentlig mängd fibronektin (fig. 6A). Fibronektininnehåll korrelerade positivt med glykemi ( P = 0, 030), HbA1c ( P = 0, 022) och ACR ( P = 0, 014) (Fig. 6D). Mängden fibronektinprotein var signifikant högre hos ob / ob- möss jämfört med deras heterozygota kullkamrater ( P <0, 01) (fig 6B). Vi fann en trend mot lägre nivåer i de karnosinadministrerade mössen, men detta var inte signifikant ( P = 0, 09) (Fig. 6B). mRNA-expressionsanalys avslöjade emellertid signifikant minskad mRNA-expression av fibronektin i de karnosin-kompletterade mössen relativt deras obehandlade kontroller ( P <0, 05) (Fig. 6C).

( A ) Representativa bilder av glomeruli immunfärgade för fibronektin (brunt) och försänkta med hematoxylin i wt / ob, ob / ob och ob / ob karnosin-kompletterade möss. ( B ) Mängden fibronektinprotein ökades i ob / ob- möss jämfört med wt / ob- kontroller. En trend observerades mot lägre fibronektininnehåll hos karnosinbehandlade djur. ( C ) Fibronektin-mRNA-uttryck (visat i förhållande till wt / ob- gruppen) minskade signifikant i karnosinbehandlade möss jämfört med ob / ob- kontroller. ( D ) Mängden fibronektinprotein korrelerade positivt med glykemi, HbA1c och albumin-kreatinin-förhållande (ACR). Data representerar betyder ± SEM. * P <0, 05, ο P = 0, 09, θ P = 0, 058 jämfört med ob / ob- möss. ## P <0, 01 jämfört med möss med wt / ob . Bil: karnosin.

Bild i full storlek

Immunfarvande för kollagen I visade att förutom fibronektin innehöll de glomerulära lesionerna också kollagen I (fig. 7A). Kollagen I-innehåll positivt korrelerat med glykemi ( P <0, 001), HbA1c ( P <0, 001) och ACR ( P <0, 001) (Fig. 7D). Mängden kollagen I ökades signifikant hos ob / ob- möss jämfört med deras heterozygota kullkamrater ( P <0, 001) (Fig. 7B). Behandling med karnosin minskade signifikant denna ökning av kollagen I ( P <0, 01) (Fig. 7B). Kollagen I-mRNA uttrycktes under detektionsgränsen. Uttryck av kollagen IV-mRNA var över sju gånger lägre i karnosin-kompletterade möss jämfört med obehandlade ob / ob- möss ( P = 0, 01) (fig. 7C).

( A ) Representativa bilder av glomeruli immunfärgade för kollagen I (brun) och försänkta med hematoxylin i wt / ob, ob / ob och ob / ob karnosin-kompletterade möss. ( B ) Mängden kollagen I-protein var signifikant högre i ob / ob- kontrolldjur jämfört med wt / ob- möss och dämpas i karnosinbehandlade djur. ( C ) Kollagen IV-mRNA-uttryck (visat i förhållande till wt / ob- gruppen) minskade signifikant i karnosinbehandlade möss jämfört med ob / ob- kontroller. ( D ) Mängden kollagen I korrelerade positivt med glykemi, HbA1c och albumin-kreatinin-förhållande (ACR). Data representerar betyder ± SEM. * P <0, 05, ** P <0, 01 jämfört med möss med ob / ob . # P <0, 05, ### P <0, 001 jämfört med wt / ob- möss. Bil: karnosin.

Bild i full storlek

Karnosin och dess akroleinaddukt ökas i serum och urin hos behandlade möss

Både karnosin och karnosin-propanal (= karnosin-akroleinaddukt) detekterades i proverna från kompletterade djur med hjälp av nanoflödesvätskekromatografi-Mass Spektometri. Analytidentitet bekräftades av de exakta massmätningarna och motsvarande MSMS-fragmenteringsmönster, som till stor del var överlagrade med spektra som nyligen rapporterades i en karnosininterventionsstudie hos människor 18 . Alla förutsagda addukter härrörande från reaktionen av karnosin med HNE eller glyoxal eller metylglyoxal eller MDA var inte upptäckbara.

Tvärtom vad som har observerats hos människor 18, var både karnosin och dess addukt inte detekterbara i icke-kompletterade djur. Jämfört med ob / ob- kontrolldjur visade kompletterade djur en signifikant ökning av karnosin och karnosin-propanal addukt både i serum (P <0, 0001 respektive P <0, 01) och urin ( P <0, 01 respektive P <0, 01) (Fig 8A – D). Den genomsnittliga karnosinkoncentrationen var högre i serum (6, 57 μM respektive 4, 24 μM), men den genomsnittliga karnosin-propanala koncentrationen lägre än i urin (0, 06 μM respektive 0, 74 μM). Båda substanserna visar ett större koncentrationsområde i urin (0, 28–17, 13 μM respektive 0, 00–3, 82 μM) än i serum (0, 07–15, 84 μM respektive 0, 00–0, 23 μM). Karnosin-propanal var under serum LLOD för 6 kompletterade djur av 14, medan i urinen endast ett kompletterat djur hade en odetekterbar nivå av addukten.

( A – D ) Karnosin- och karnosin-propanala nivåer ökas signifikant i serum och urin hos behandlade möss jämfört med ob / ob- möss (data visas i en låda med kurvor som utvidgas till minimi- och maximivärden). ( E, F ) Karnosinnivåer i serum och urin hos behandlade möss signifikant korrelerade med respektive adduktnivåer i samma prov. ( G, H ) ACR hos behandlade djur korrelerade signifikant med karnosin-propanal urin. HbA1c-nivåerna visade en liknande trend, men denna korrelation var inte statistiskt signifikant ( P = 0, 065). **** P <0, 0001, ** P <0, 01 jämfört med ob / ob- möss. ## P <0, 01, # P <0, 05 jämfört med wt / ob- möss. Bil: karnosin; Car-Pal: karnosin-propanal.

Bild i full storlek

Vi fann en signifikant korrelation mellan nivåer av karnosin och karnosin-propanal i både serum ( P <0, 0001) och urin ( P <0, 05) av behandlade djur (fig. 8E, F). Intressant nog korrelerade ACR i behandlade djur signifikant med karnosin-propanalnivåer ( P <0, 05) (Fig. 8G). Vi hittade en liknande trend för HbA1c-nivåer, men denna korrelation nådde inte statistisk signifikans ( P = 0, 065) (Fig. 8H).

Karnosin upphäver akroleintoxicitet in vitro genom hämning av proteinkarbonylering

Baserat på upptäckten av betydande generering av karnosin-akroleinaddukt i urin och sera från kompletterade BTBR-möss undersökte vi om karnosin skulle kunna påverka livskraften hos celler exponerade för akrolein. För detta ändamål utsattes HUVEC för olika koncentrationer av akrolein under 24 timmar i närvaro eller frånvaro av 20 mM karnosin. Vid akroleinkoncentrationer av 1, 3 nM till 130 μM avslöjade ljusmikroskopi signifikant toxicitet när cellerna blev rundformade och likformigt lossade från ytan. Celler som inkuberades med karnosin uppvisade en helt normal morfologi (Fig. 9A). Vid akroleinkoncentrationer större än 130 μM var toxiciteten mer och mer maskerad på grund av en omedelbar fixeringsegenskap för akroleinbesparande cellmorfologi. För att objektivera effekten på cellviabilitet genomfördes en MTT-analys. Det bekräftade toxicitet av akrolein över hela det använda koncentrationsområdet (1, 3 nM - 130 μM), vilket signifikant upphävdes av karnosin ( P <0, 0001 för alla koncentrationer) (Fig. 9B). För att identifiera mekanismen bakom detta skydd bestämde vi mängden karbonylerade proteiner i celllysat med hjälp av OxyBlot-tekniken. De resulterande fläckarna avslöjade förbättrad signalintensitet för karbonylerade proteiner i celler utsatta för olika koncentrationer av akrolein, vilket tydligt reducerades i närvaro av karnosin (fig. 9C). För att bevisa att denna hämning av cellulärt proteinkarbonylering beror på en reaktion av karnosin med akrolein, bedömde vi karnosin-akroleinadduktnivåer i cellsupernatanter med hjälp av masspektrometri (fig. 9D). Karnosin-akrolein Michael-addukter identifierades endast i supernatanterna i celler som inkuberades med både akrolein och karnosin. Närvaron av denna addukt bekräftades med en kromatografisk topp vid 5, 2 minuter för det enda jon-kromatogramet som extraherades med användning av det teoretiska m / z- värdet som addukt som filter. En sådan topp var detekterbar i prover som inkuberades med en akroleinkoncentration över 0, 13 mM och visade en signalökning proportionell mot mängden akrolein närvarande i cellmediet. Dessutom hade spektratbasstoppen vid 283.14008 ett m / z delta-massvärde på endast +0, 2 ppm från det förväntade adduktvärdet. Strukturell bekräftelse uppnåddes genom att jämföra experimentella fragmenteringsspektra för den detekterade produkten och en standardkarnosin-akrolein Michael-addukt. Ett liknande svarsmönster observerades för addukter från multipel akroleinadduktion, speciellt för MP-karnosin som var detekterbart på dosberoende sätt i supernatanterna i celler inkuberade med akrolein i koncentrationer högre än 1, 3 mM (data visas inte).

( A ) Inkubation av HUVEC med 130 nM akrolein under 24 timmar ledde till celldöd, vilket var fullständigt omvänt när det sam-inkuberades med karnosin. Analoga resultat observerades för akroleinkoncentrationer så låga som 1, 3 nM. ( B ) Kvantitativ MTT-analys (n = 6 för varje tillstånd) avslöjade fullständig cytotoxicitet för akroleinkoncentrationer från 1, 3 nM till 130 μM. Carnosine-inkubation återställde cellvärdigheten. ( C ) Representativa OxyBlot-resultat av lyserade celler efter 24 timmars inkubation med akrolein i närvaro eller frånvaro av karnosin. Signalintensiteten hos band som representerar karbonylerade proteiner ökades i akroleinstimulerade celler. Denna ökning minskades i närvaro av karnosin. Prover utan tillsats av derivatlösning tjänade som negativa kontroller. ( D ) Identifiering av karnosin-akrolein Michael-addukt i cellsupernatanter. 1) Enkeljonskromatogram av cellsupernatanter innehållande en fast mängd karnosin (20 mM) och inget akrolein (svart linje), 0, 13 mM akrolein (orange linje), 1, 3 mM akrolein (grön linje) eller 13 mM akrolein (blå linje) rekonstituerad genom att ställa in filterjonen på m / z 283.14014. 2) Tandem masspektrum av jonen vid m / z 283.14014 detekterat i cellsupernatanter. 3) Tandem masspektrum av en standard karnosin-akrolein Michael-addukt. 4) Karnosin-akroleinaddukter detekterade i cellsupernatanter. * P <0, 01, **** P <0, 0001. Bil: karnosin. Deri: härledningslösning.

Bild i full storlek

Diskussion

I denna studie hypotes vi att behandling med L-karnosin kan förbättra funktioner hos DN i BTBR ob / ob- modellen. Tidigare tillvägagångssätt har redan indikerat en gynnsam effekt av karnosin på flera aspekter av manifestation av diabetisk sjukdom, men alla misslyckades inte med att verifiera förbättring av DN på morfologisk nivå. Dessa begränsningar kan tillskrivas de musmodeller som används, eftersom de alla endast representerar tidiga funktioner hos njurskador. Dessutom tillät STZ-medierad hyperglykemi inte en analys av effekterna av karnosin på p-cellfunktion, eftersom de insulinproducerande cellerna eliminerades. Vi försökte övervinna dessa hinder genom att använda BTBR- ob / ob- musmodellen som resulterar i utvecklingen av progressiv njurpatologi. De viktigaste resultaten av vår utredning är följande. Administrering av karnosin ledde till förhöjda karnosin- och karnosin-karbonyladdukter, förbättrade både glukosmetabolism och albuminuri, återställd glomerulär ultrastruktur och hypertrofi och förändrade molekylkompositionen för den expanderade mesangiala ECM.

Karnosinadministrerade möss uppvisade lägre FPG under hela observationsperioden, vilket bekräftades av en lägre HbA1c. Observera att i obehandlade ob / ob- möss glykemi ofta överskred detekteringsområdet (> 600 mg / dl), så skillnaderna i FPG kan bli ännu mer uttalade i verkligheten. Våra resultat överensstämmer med andra studier som också har rapporterat glukossänkande effekter av karnosin 19, 20 . I denna studie åtföljdes förbättrad glykemisk kontroll hos behandlade möss av tvåfaldiga ökade seruminsulinnivåer jämfört med icke-behandlade ob / ob- möss. Den negativa korrelationen mellan glykemi och seruminsulin hos behandlade möss tyder på att förhöjning av insulinnivåer signifikant bidrar till de glukos-sänkande effekterna av karnosin. I själva verket är otillräcklig holmkompensation en avgörande faktor för predispositionen av BTBR-stammen till accelererad diabetes 13 . Dessutom verkar det osannolikt att hyperinsulinema i den karnosinadministrerade gruppen är en följd av minskad metabolisk kontroll, eftersom en positiv korrelation kan förväntas i det fallet. Effekter av karnosin på p-cellmassa beskrivs tidigare 21, men vi kunde inte bekräfta detta eftersom vår histologiska analys visade en fokal expansion av p-celler med en omfattande individuell variation. Eftersom karnosinbehandlade möss uppvisade signifikant högre C-peptidnivåer verkar det troligt att karnosin hade en stimulerande effekt på insulinsekretion, vilket kan vara resultatet av antingen direkt internalisering av karnosin i pankreatiska p-celler eller genom åtgärder av dess två bestående aminosyror ß- alanin och histidin. Karnosin är ett substrat hos den protonkopplade peptidtransportören 1 (PEPT1) som har visat sig uttryckas i bukspottkörtelvävnad och kan aktivera insulinsignalerande kaskad 22 . Parallellt hydrolyseras en avsevärd mängd karnosin efter intag i enterala celler av karnosinas-2 (vävnadskarnosinas) och frigörs i cirkulationen via aminosyratransportörer 23 . Det är välkänt att aminosyror kan stimulera glukosberoende insulinrespons; i synnerhet har både histidin och alanin implicerats för att påskynda insulinsekretionen 24, 25, 26 . P-alanin kan komma in i bukspottkörtelcellerna tillsammans med depolariserande Na + -joner via den natriumberoende TauT (taurintransportör) vilket resulterar i öppning av spänningsaktiverade L-typ Ca 2+ -kanaler 27, 28 . Efter internalisering via LAT1 (L-typ neutral aminosyratransportör 1) 29, kunde histidin metaboliseras till a-ketoglutarat, vilket går in i Krebs-cykeln efter fullständig oxidation till CO 2 därmed höjer ATP / ADP-förhållandet och därefter insulinnivåer. För det andra, som en katjonisk aminosyra, kan histidin orsaka grindning av spänningskänsliga Ca 2+ -kanaler som ett resultat av primär depolarisering av plasmamembranet. I hypotalamiska neuroner kan karnosin metaboliseras till den neuronala sändaren histamin 30 och binda till den presynaptiska H3-receptorn vilket resulterar i insulinsekretion 31, 32 .

Klinisk diagnos av DN baseras på onormal albuminutsöndring. Vid livets vecka 24 mätte vi en signifikant ökning av ACR hos ob / ob djur, vilket minskades mer än två gånger genom karnosinbehandling. I själva verket, efter tio veckors liv stoppade karnosinbehandlingen ytterligare framsteg av albuminuri. Detta åtföljdes av en återställd glomerulär ultrastruktur i karnosin-kompletterade möss som kontrasterar den avancerade skadan som fanns i ob / ob- kontrollmöss, inklusive podocyt-effacement, GBM-förtjockning och endotelial dysfunktion. Tvärtom, WT1-färgningen visade inte några skillnader mellan kontroll- och karnosinbehandlade djur. Det är viktigt att nyare studier identifierade podocytskada snarare än podocytförlust som den primära strukturella faktorn som ansvarar för förlust av glomerulär selektivitet 33 . Likaså är minskningen av WT-1-positiva celler som hittades vid vecka 24 (ungefär två / glomerulus) osannolikt att förklara 50x skillnaden i proteinuria mellan ob / ob och wt / ob- möss, medan denna skillnad är mycket överensstämmande med den uttalade podocytskada hittade ultrastrukturellt.

Så vitt vi vet är detta den första studien som avslöjade en påverkan av karnosin på glomerulär hypertrofi. BTBR ob / ob- möss uppvisade en ökad glomerulär hypertrofi, kännetecknad av en 2, 2 gånger högre Bowmans kapselytyta. En nyligen genomförd patientstudie illustrerade att överviktiga personer som uppvisade proteinuria visade en tvåfaldig ökning av Bowmans rymdvolym jämfört med mager kontrollpersoner 34 . I vår musmodell kunde karnosin avsevärt minska storleken på njurkapseln huvudsakligen via en minskning av ytan i Bowmans rymd. Eftersom vi utesluter krympning av glomerulära kapillärer är denna minskning i storlek troligtvis en följd av minskad glomerulär hyperfiltrering. Faktum är att närvaron av hyperfiltrering i BTBR ob / ob- musen har beskrivits nyligen 16 . Glomerulär hyperfiltrering anses vara en av de viktigaste händelserna i utvecklingen av DN 35 . Den kliniska betydelsen framgår när man inser att ACE-hämmare fortfarande är det enda läkemedlet för diabetespatienter med nefropati för att försena progression. En mycket ny studie på D-karnosin-oktylester (ett biotillgängligt karnosinderivat) i STZ-behandlade diabetiska ApoE-null-möss visade liknande resultat med reducerad njurhypertrofi och albuminuri, men ingen effekt på kolesterol 36 . Eftersom glykemisk kontroll förblev opåverkad i denna modell spekulerar vi att åtminstone en del av renobeskyddningen medieras av karnosin, medan den insulinotropa effekten kan förmedlas av histamin och ß-alanin.

Karnosinbehandling reducerade avsättningen av fibronektin och kollagen I genom mesangialceller och mRNA-uttryck av fibronektin och kollagen IV. En in vivo- effekt av karnosin på sammansättningen av ECM har aldrig beskrivits tidigare. Detta kan bero på det faktum att BTBR ob / ob- möss utövar starkt ökade ansamlingar av mesangial matris även jämfört med C57BLKS / J db / db musmodell 11 . Uttrycket av kollagen I-mRNA var under detektionsgränsen, eftersom det endast uttrycks i avancerad glomeruloskleros 37 .

Nyligen dök upp ett växande intresse för förmågan hos karnosin att släcka reaktiva karbonylarter genom Schiff- basbildning 38, 39, 40 . Akrolein är den mest reaktiva av a, p-omättade aldehyder och har associerats med diabetisk nefropati 41, 42 . I denna studie ledde oralt karnosintillskott inte bara till ökade karnosin utan också karnosin-karbonylnivåer. Det goda sambandet mellan koncentrationen av karnosin och karnosinaddukt i serum och urin antyder att kompletterat karnosin reagerade med endogent akrolein för att generera stabila addukter som utsöndrades i urin. Efterföljande in vitro- experiment med HUVEC visade en fullständig reversering av akroleintoxicitet i närvaro av karnosin, vilket parallelliserades genom en signifikant reduktion av cellulär proteinkarbonylering, bedömd med OxyBlot-tekniken. Masspektrometri bekräftade neutralisering av den reaktiva aldehyden i cellsupernatanter. Det faktum att inga addukter hittades i supernatanter från celler exponerade för akroleinkoncentrationer lägre än 130 μM beror på analysens känslighetsbegränsningar. Eftersom karbonylering resulterar i proteindysfunktion och bildning av AGE-medel som är inblandade i diabetes, kan avgiftning av de reaktiva prekursorerna med karnosin vara en central mekanism för de skyddande effekterna som observeras i BTBR-möss 43 . Bevis för denna hypotese kommer från den senaste upptäckten att urinakroleinmetaboliter är förknippade med diabetes och insulinresistens 44 .

Though it is difficult to differentiate direct renoprotective effects from those secondary to improved glycemia as a consequence of elevated insulin levels, we assume that direct actions play an essential role in the findings of this study and need to be considered separately. In particular, the profound differences in albuminuria and at the ultrastructural level indicate mechanisms beyond attenuation of glycemic control, one of which may be the neutralization of reactive carbonyl species as demonstrated in vivo and in vitro . In fact, there is a considerable amount of evidence on renoprotective effects of carnosine. Studies report carnosine-induced diminishment of fibronectin and collagen type VI production in podocytes and normalization of TGF-beta production in mesangial cells incubated with high glucose medium 6, 45 . Other mechanisms include the inhibition of lipid peroxidation, glycation and oxidative modifications of proteins by carnosine 46, 47 . Of note, methylglyoxal, an endogenous metabolite accumulating in diabetes, can be neutralized by carnosine 48 . Even anti-ageing effects in T cells extending the lifespan under physiological oxygen tension have been described 49 . Additional supportive in vivo data comes eg from ischemia/reperfusion models 50, 51 and STZ-rendered diabetic mice with renal improvement despite unaffected glycemic control 10, 36, 52 .

A major limitation of this study results from differences between murine and human carnosine metabolism. In contrast to humans, rodents do not secrete carnosinase-1 in the circulation. However, this enzyme very efficiently breaks down carnosine into its two components β-alanine and L-histidine. Therefore, in humans oral supplementation only leads to minimal increases 53 . However, we have recently shown that the human kidney is able to synthesize its own carnosine after ingestion of the individual amino acids 54 . Since in mice higher systemic concentrations can be achieved, the translational significance using a rodent model may be limited. To address this obstacle, we currently establish a BTBR ob/ob mouse model transgenic for human CN1, which will be subject of a separate report. Further studies on carnosine in diabetes are warranted to investigate the mechanisms relevant for insulin sensitivity, glucose tolerance and possible implications on the inflammatory phenotype.

In conclusion, we have demonstrated that treatment with carnosine is able to attenuate both glucose metabolism and albuminuria in more advanced stages of DN. This was mirrored morphologically in restored glomerular ultrastructure, reduced glomerular hypertrophy and modifications of the ECM composition. Therefore, carnosine could be a promising therapeutic treatment modality to ameliorate both diabetes and the development of DN.

metoder

Experimental design

All experiments and methods were performed in accordance with relevant guidelines and regulations. All animal procedures were approved by the Regierungspräsidium Karlsruhe (AZ 35-9185.81/G-119/11). Six-week old male BTBR mice were purchased from Jackson Laboratories (Bar Harbor, ME, USA) and divided into three groups: BTBR wt/ob (n = 5), BTBR ob/ob (n = 15) and BTBR ob/ob supplemented with 45 mg/kg body weight L-carnosine (n = 15) dissolved in drinking water (4 mM; Flamma, Italy) as previously described 21 . BTBR wt/ob mice served as a negative control of the BTBR ob/ob mouse model for DN, since these mice are not leptin deficient. Mice were housed at 22 °C in a 12 h light/dark cycle and fed regular chow ad libitum. Drinking bottles containing carnosine were replaced at least every third day to guarantee stability. Body weight, and fasting plasma glucose (FPG) were assessed weekly at the beginning of the light cycle after a 5-hours fasting period using an OneTouch Verio IQ blood glucose meter (LifeScan, Milpitas, CA). Glycated hemoglobin (HbA1c) was measured using the in2it A1C system (Bio-Rad, Hercules, CA). At week 24 of age (after 18 weeks of treatment), blood samples were collected from the orbital plexus under anesthesia. Proteinuria was determined using the ACR instead of a 24-hour total urinary albumin excretion since the BTBR strain is very susceptible to stress and due to recent studies showing equivalence of both measures 55 . To obtain morning spot urine samples, animals were placed in metabolic cages for two hours at the beginning of the light cycle and received only water but no food. Creatinine, blood urea nitrogen and cholesterol concentrations were measured using a Cobas ® C311 Autoanalyzer (Roche Diagnostics, Indianapolis, USA) according to the manufacturer's procedures. Urinary albumin, insulin, glucagon, C-reactive protein and C-Peptide were determined by ELISA.

Histological analysis

After 18 weeks of treatment, mice were sacrificed by vascular perfusion fixation through the aorta with 4% paraformaldehyde under ketamine/xylazine anesthesia. Kidneys were isolated and weighed. A subset of kidneys was also preserved cryogenically. Tissues fixed with paraformaldehyde were embedded in paraffin, cut in 4 μm sections, deparaffinized with xylol and dehydrated using an ethanol gradient. Sections were stained with periodic acid-Schiff (PAS) and hematoxylin and eosin (H&E). Stained slides were digitalized with Philips Digital Pathology Solutions (Philips Electronics) for morphological measurement. PAS-stained kidney tissue was graded blindly on a scale of I to IV depending on the amount of mesangial matrix: I, 0–10%; II, 10–50%; III, >50%; IV: global glomerular sclerosis. For electron microscopy, 1-mm-thick slices were fixed with 3% glutaraldehyde in 0, 1 M CaCo buffer. After processing and sectioning according to standard protocols, two EM-samples of each diabetic group were examined blindly.

Immunohistochemistry

Sections were deparaffinized and rehydrated as described above. For immunostainings of Wilms tumor protein (WT1), cleaved caspase-3 and collagen I, antigen retrieval was performed using Tris/EDTA buffer (pH 9.0, 10 mM; 20 min, 100 °C), citrate buffer (pH 6.0, 10 mM; 20 min, 100 °C) or pepsin (0.4% in 0.1 HCL; 15 min, 37 °C), respectively. Endogenous peroxidase was blocked with 0.12% H 2 O 2 in Milli-Q (20 min, RT), followed by incubation with primary antibody diluted in 1% BSA in PBS. Antibodies used were (1) rabbit anti-fibronectin (Sigma-Aldrich, St.Louis, MO); (2) rabbit anti-collagen I (AbD Serotec, Puchheim, Germany); (3) rabbit anti-WT1 (Santa Cruz Biotechnology, Santa Cruz, CA); and (4) rabbit anti-cleaved caspase-3 (Cell Signaling Technology, Danvers, MA). Negative controls for immunohistochemistry included normal sera of the same species as the primary antibody. The immunoreactions were visualized with 3, 3-diaminobenzidine (Dako), counterstained with hematoxylin, dehydrated, and mounted. Cell numbers were determined by randomly analyzing 25 glomeruli of each experimental animal. Sections stained for fibronectin and collagen I were digitalized and graded blindly on a scale of I to V depending on the staining intensity: I, none; II, minute; III, moderate; IV, high; V, very high.

RNA isolation, cDNA synthesis and quantitative RT-PCR

TRIzol RNA isolation reagent (Thermo Fisher Scientific) was added to the subset of cryogenically preserved kidney tissue. The samples were incubated (3 min) with chloroform and centrifuged (13.000 rpm; 10 min, 4 °C). The supernatant was isolated and RNA was precipitated using isopropanol (20 min, RT) and centrifuged (13.000 rpm; 10 min, 4 °C). The obtained pellet was washed with 75% ethanol and centrifuged (13.000 rpm; 10 min, 4 °C). Thereafter, the pellet was dried, dissolved in nuclease-free water and incubated for 10 min at 60 °C. The RNA concentration and quality was determined with a Nanodrop spectrophotometer (Thermo Scientific). Total RNA was reverse-transcribed with AMV-RT (Roche). The RT-PCR was performed with a SYBR Green kit (Bio-Rad) on a CFX96 RT-PCR Detection System (Bio-Rad). Primers used for detection of mouse fibronectin were GGCAGGCTCAGCAAATCG (forward) and CATAGCAGGTACAAACCAGGG (reverse), and for detection of mouse collagen IV CGTCTCTGCTGGTCCCCT (forward) and GGCAAGCCTCTTTCTCCCTT (reverse). mRNA expression of genes of interest was compared to mRNA expression of housekeeping genes ( HPRT and GAPDH ).

Nano flow Liquid Chromatography-Mass Spectometry

Before analysis, urine samples were diluted ten fold with 1% (v/v) aqueous perfluoropentanoic acid (mass spectrometry grade, Sigma-Aldrich, Milan, Italy) containing 1 μm of the internal standard tyrosyl-histidine (Flamma SpA, Chignolo d'Isola, Bergamo, Italy). Samples were centrifuged at 14.000 g for 10 minutes to precipitate insoluble particles. Serum samples were deproteinized by adding acetonitrile (LCMS grade, Sigma-Aldrich, Milan, Italy) up to 80% (v/v) and kept at 5 °C for 10 minutes. The samples were then spun as described above and the supernatants collected and evaporated at room temperature by a RVC 2–18 rotational vacuum concentrator. Dried residues were re-dissolved in 1% (v/v) aqueous PFPA containing the internal standard to have a ten-fold final dilution of serum.

Calibration samples were prepared in triplicates by spiking carnosine in blank matrices at the following final concentrations: 0.5, 1, 10, 50, 100, 500 μM for urine and 0.5, 1, 10, 50, 100 μM for serum. Calibration curves were built by least square linear regression plotting the nominal concentration of the analytes (x axis) versus the analytes/internal standard peak area ratio (y axis). One calibration curve was prepared using commercially available rodent serum to calculate carnosine concentrations in serum samples. Since rodent urine was not available commercially, a second calibration curve was prepared using human urine from a vegan volunteer to calculate urinary carnosine concentrations. A vegan subject was recruited since background carnosine is detectable in human urine, but it was reported that a meat-free diet significantly reduces carnosine urinary concentration 18 .

Before preparing calibration curves, blank matrices were checked. Carnosine adducts were not detected in any matrix, while carnosine was detectable only in blank urine at a concentration below the LLOQ of the analytical method.

The analytic platform was composed of a Dionex UltiMate3000 nano-flow LC system connected to an LTQ-Orbitrap XL mass spectrometer through a nanoelectrospray ionization source (NSI), assembled by a Finnigan NSI-1 dynamic probe equipped with a stainless steel LC/MS emitter (5 cm length, OD 150 μm, ID 30 μm, Thermo Fisher, Rodano, MI, Italy).

The chromatographic separation was performed at 30 °C at a flow rate of 200 nL/min by using a binary gradient of mobile phase A (water containing 0.1% formic acid) and mobile phase B (acetonitrile containing 0.1% formic acid). Sample loading was performed at 30 °C at a flow rate of 5 μL/min by using water containing 0.1% PFPA as mobile phase. Sample loading and cleanup/desalting was performed into an Acclaim ® PepMap 100 trap column (100 μm × 2 cm, C18, 5 μm, 100 Å, Thermo Fisher Scientific, Rodano, MI, Italy), while an Acclaim ® PepMap 100 (100 μm × 15 cm, C18, 5 μm, 100 Å, Thermo Fisher Scientific, Rodano, MI, Italy) was used as analytical column.

The flow was kept diverted to the waste for 4 minutes to allow sample loading/cleanup, afterwards the trap column was switched to be in line with the analytical column. The elution of the analytes was performed by a multi-step gradient starting with a 5-minute isocratic flow at 1% mobile phase B (99% mobile phase A), followed by a 12-minute linear gradient (1–99% mobile phase B, 99–1% mobile phase A) and eventually a 10-minute program for washing the column with 99% B and re-equilibrating the system to the initial conditions.

The flow coming from the column was sprayed directly into the mass spectrometer by the NSI source without using auxiliary gas. The source was operating in positive ion mode as follows: spray voltage 1.7 kV, capillary temperature 200 °C and capillary voltage 35 V.

During the chromatographic separation the MS spectra were acquired in profile mode by the Orbitrap using the following settings: scan range 200–600 m/z, 5 × 10 5 ions per scan, maximum inject time was set to 500 ms, resolution was set to 30000 (FWHM at m/z 400).

Data dependent feature was enabled to collect MS/MS spectra for the six most intense ions of each scan exceeding a count of 5 × 10 4, using the linear ion trap and the following settings: centroid mode, precursor ions isolation width of 3 m/z, 1 × 10 4 ions per scan, maximum inject time was set to 1000 milliseconds. Collision energy of 35% and an activation time of 30 milliseconds were used for CID fragmentation with wideband option enabled.

Dynamic exclusion was enabled to reduce redundant MS/MS spectra acquisition using default settings and an exclusion window of 20 ppm. Charge state screening and monoisotopic precursor selection were enabled to allow fragmentation of singly charged ions only. Lock mass option was enabled to provide a real time internal mass calibration during the analysis using as reference a list of 20 abundant and known background signals already reported by Keller et al . as common air contaminants in mass spectrometry 56 . Instrument control was provided by the software Xcalibur and Chromeleon Xpress.

Carnosine and carnosine adducts were identified based on accurate mass measurements and corresponding CID fragmentation patterns. Peak areas were calculated from extracted single ion chromatograms (SICs), centered within a tolerance window of 10 ppm from the theoretical mass values of internal standard, carnosine and carnosine adducts.

Carnosine concentration was calculated using the corresponding calibration curves for serum and urine. Adduct concentration was determined by the following equation:

(AA = aduct peak area, CA = carnosine peak area).

Cell culture and isolation

Human umbilical vein endothelial cells (HUVEC) were isolated from fresh umbilical cords. The cells were cultured in essential growth medium for endothelial cells in gelatine-coated culture flasks at 37 °C, 95% relative humidity and 5% CO 2 . Confluent monolayers were passaged by trypsin 0.025%/EDTA 0.01%. For MTT assays, HUVEC were seeded in 96-well plates at a density of 3 × 10 4 cells/well and grown until confluence. HUVECs were used in passages 3–5 and all results confirmed in at least three independent experiments.

MTT (3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide) tetrazolium reduction assay

HUVEC were stimulated for 24 hours with different concentrations of acrolein (1.3 nM–130 μM) in the absence or presence of 20 mM of carnosine. Cells maintained in normal culture medium or in culture medium to which 20 mM of carnosine was added served as control. Hereafter, all supernatants were aspirated and replaced by 200 μL of MTT reagent (0.5 mg/ml) and the plates were incubated for 6 hours at 37 °C, 95% relative humidity and 5% CO 2 . After conversion of MTT into a purple coloured formazan product in viable cells, the plates were aspirated and wells were filled with a solubilization solution containing 4 parts DMSO, 4 parts 10% w/v SDS and 2 parts of PBS/acetic acid in a final concentration of 1.2% v/v. The plates were incubated overnight and recorded at 560 nm with reference wavelength at 670 nm. Relative cell viability was assessed as ratio of OD sample/OD control, both background-corrected.

Protein extraction and OxyBlot

HUVEC were resuspended in lysis buffer (10 mM Tris–HCl, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, 1 μM dithiothreitol (DTT), proteinase inhibitor cocktail and phosphatase inhibitor). Protein concentrations were measured using Coomassie-Reagent (Pierce, Rockford, USA). Samples (5 μg protein extract) were subjected to the OxyBlot protocol (Merck, Darmstadt, Germany) according to the manufacturer's instructions, loaded and separated on 10% SDS-polyacrylamide gels followed by semi-dry blotting onto PVDF membranes (Roche, Mannheim, Germany). The membranes were incubated with 5% w/v non-fat dry milk or bovine serum albumin in TBS/Tween 0.1% to block unspecific background staining and hereafter incubated for one hour at 4 °C with primary antibody, specific to the carbonyl group derivatization product (2, 4-dinitrophenylhydrazone). Subsequently, the membranes were thoroughly washed with TBS-Tween 0.1% and incubated with the appropriate horseradish peroxidase conjugated secondary antibody, followed by five times wash in TBS/Tween 0.1%. Proteins were visualized using enhanced chemoluminescence technology, according to the manufacturer's instructions (Pierce, Rockford, IL, USA).

Carnosine-acrolein adduct identification in cell supernatants

Before analysis, supernatants from HUVECs exposed to various acrolein concentrations in absence or presence of carnosine were centrifuged for 10 minutes at 14000 g, filtered through 0.45 μm membrane and diluted 200 fold with 0.1% aqueous formic acid.

Chromatographic separations were performed by a Hypersil GOLD HILIC column (150 × 2.1 mm, 3 μm) using an UltiMate3000 chromatograph (Thermo Scientific, Rodano, MI, Italy). The separation program started with a 2 μL partial loop injection of diluted supernatants. The analytes of interest were then eluted by a binary gradient using pure acetonitrile as mobile phase A and 0.1% aqueous formic acid as mobile phase B. The elution program started with a one-minute isocratic flow at 10% mobile phase B, followed by a linear ramp up to 40% mobile phase B in 4 minutes which was then kept constant for an additional 4 minutes before a five-minute program to re-equilibrate the system to the initial condition.

The flow coming from the column was sprayed directly into an LTQ Orbitrap XL mass spectrometer by a Finnigan Ion Max electrospray interface (Thermo Scientific, Rodano, MI, Italy). Nebulization was achieved using a spray voltage of 5 kV, a capillary temperature of 275 °C and 35 units of sheath gas. During the elution, the detector scanned positive ion mass spectra in a 200–600 m/z range at a resolution of 100000 (FWHM at 400 m/z). Tandem mass spectra were acquired in ion trap for any ion within 5 ppm of the predicted m/z values for the main carnosine-acrolein adducts, namely carnosine-acrolein Michael adduct (283.140082 m/z), carnosine-acrolein Schiff base ( m/z 265.129517), N-terminus-(3-formyl-3, 4-dehydropiperidino)carnosine (FDP-carnosine, m/z 321.155732) and N-terminus-(3methylpyridinium)carnosine (MP-carnosine, m/z 303.145167).

Full instrument control and extraction of peak areas used for quantitation were provided by Xcalibur and Chromeleon Xpress software (version 2.0.7, Thermo Fisher Scientific, Rodano, MI, Italy).

Statistisk analys

All data are expressed as mean ± SEM. Statistical analysis was performed using one-way ANOVA. Significant omnibus results were followed by Fisher's LSD test, which is more powerful than alternatives when testing differences among three groups 57 . To compare the means of two groups, quantitative analysis was carried out using unpaired, two-tailed t-test. Two-tailed, Pearson's correlation was performed to identify correlations using SPSS 20 software package for Windows (SPSS, Chicago, IL). Differences were considered statistically significant at P < 0.05.

ytterligare information

How to cite this article : Albrecht, T. et al . Carnosine Attenuates the Development of both Type 2 Diabetes and Diabetic Nephropathy in BTBR ob/ob Mice. Sci. Rep. 7, 44492; doi: 10.1038/srep44492 (2017).

Förlagets anmärkning: Springer Nature förblir neutral när det gäller jurisdiktionskrav i publicerade kartor och institutionella anslutningar.

kommentarer

Genom att skicka en kommentar samtycker du till att följa våra villkor och gemenskapens riktlinjer. Om du finner något missbruk eller som inte överensstämmer med våra villkor eller riktlinjer ska du markera det som olämpligt.