Antika horisontella överföringar av retrotransposoner mellan fåglar och förfäder till mänskliga patogena nematoder | naturkommunikation

Antika horisontella överföringar av retrotransposoner mellan fåglar och förfäder till mänskliga patogena nematoder | naturkommunikation

Anonim

ämnen

  • Evolutionsgenetik
  • Phylogenetics
  • Befolkningsgenetik

Abstrakt

Parasitvärdomkopplare kan utlösa sjukdomens uppkomst, men förhistoriska värdintervall är ofta okända. Lymfatisk filarias och loiasis är huvudsakliga mänskliga sjukdomar orsakade av insektsburna filariala nemoder Brugia , Wuchereria och Loa . Här visar vi att genomema av dessa nematoder och sju tropiska fågellinjer uteslutande delar ett nytt retrotransposon, AviRTE, som är resultatet av horisontell överföring (HT). AviRTE-subfamilier uppvisar 83–99% nukleotididentitet mellan genom och deras fylogenetiska fördelning, paleobiogeografi och invasionstider tyder på att HT: er involverade filariala nemoder. HT: erna mellan fågel- och nematodgenom ägde rum i två pantropiska vågor, > 25–22 miljoner år sedan (Myr sedan) som involverade linjen Brugia / Wuchereria och> 20–17 Myr sedan med Loa- linjen. I motsats till förväntningarna från det däggdjursdominerade värdspektrumet av filariala nemoder, antar vi att dessa stora mänskliga patogener kan ha oberoende utvecklats från fågelendoparasiter som tidigare infekterat den globala bredden av fågelns biologisk mångfald.

Introduktion

Horisontell överföring (HT) av genetiskt material har vida formade eukaryota genom 1 och kan ofta sammanfalla med endosymbios 2 eller parasitism 3 . En växande mängd bevis tyder på att värd-parasitförhållanden är gateways för HT av transposerbara element (TE), genomiska parasiter som inte kan lämna cellen på egen hand. Sådant utbyte av TEs över cellulära och organismala gränser verkar vara särskilt vanligt i DNA-transposoner 4, 5, 6, medan det är ganska sällsynt i retrotransposoner, som uppvisar RNA-mellanprodukter 7, 8, 9 . Det enda kända fallet med utbredd HT av icke-retrovirala retrotransposoner är det av BovB, en familj av retrotransposonliknande element (RTE) som finns i genomerna hos olika däggdjur och ödlor / ormar 10, 11, samt fästingar som parasiterar dem 11 . Ytterligare bevis finns för en enda HT av CR1-retrotransposoner mellan avlägsna grupper av fjärilar 12 . Trots den senaste sekvenseringen av många genom av fåglar 13 och filariala nematoder 14, 15, 16, 17, finns emellertid inget bevis på HT i den evolutionära historien för dessa artsrika taxor.

Här rapporterar vi utbredd retrotransposon HT mellan endoparasitiska nematoder och bredden av aviär biologisk mångfald i tropikerna. Överraskande nog är dessa filariella nematoder existerande endoparasiter hos människor och orsakar lymfatisk filarias och loiasis, som drabbar ∼ 170 miljoner människor 14, 16 . Vi rekonstruerar tidtagningen och biogeografin för dessa förhistoriska värdparasitföreningar, vilket bevittnas av HT-händelser, och föreslår därmed ett nytt scenario för det djupa ursprunget till två stora mänskliga sjukdomar.

Resultat

Ett tidigare oupptäckt transposon från fåglar och nematoder

Vi beskriver AviRTE, en ny familj med långa ispedd element (LINE), från fågel- och nematodgenom. AviRTE tillhör RTE-superfamiljen, är avlägset besläktad med BovB (fig. 1) och ännu mer avlägset relaterad till kända nematod-RTE: er (kompletterande fig. 1). Istället grupperar AviRTE inom en mångfaldig uppsättning RTE: er från akvatiska eller semi-akvatiska djur (Fig. 1c, Kompletterande Fig. 1). Många av dessa relaterade och igenkännliga RTE-familjer kommer från krokodilier och sköldpaddor, ett mönster som kan återspegla den låga utvecklingshastigheten för dessa genom, som är rika på gamla upprepningar 18 . Vi upptäckte initialt fragment av AviRTE i restriktionsställe-associerade DNA-sekvenser (RAD) -sekvenser av ett Zimmerius- flycatcher (Tyrannidae) -genom och i BLASTN-sökningar av sekvenser från andra Tyrannidae i GenBank (kompletterande data 1). Det är troligt att dessa träffar är resultatet av kontaminering och utgör i stället faktiska TE-införingar, eftersom vi kunde konstatera ortologa genomiska lokaler av AviRTE-närvaro / frånvaro bland flera fåglarter. Exempelvis uppvisar ornitindekarboxylasgenen en intronisk AviRTE-insättning (häckt inom en 13-bp målplatsduplikering) i vissa suboscinfåglar och ett tomt insertionsställe i andra (kompletterande figur 2). Vi undersökte sedan av BLASTN 48 nyligen publicerade fågelgenom 13, ett brett spektrum av nematodgener 14, 15, 16, 17, VectorBase insekts- och fästgenom 19 och GenBanks nukleotid- och genomsamling (inklusive däggdjursgenom). Vi undersökte också sekvensbestämda genomerna från tre kolibrier och två extra suboscine passerines. Förutom dessa screeningar kompletterade vi vårt taxonprovtagning med riktad PCR av genomiskt DNA från olika fågelarter (kompletterande fig. 3; kompletterande data 1).

Image

( a, b ) Schematisk illustration av strukturell mångfald av ( a ) autonoma AviRTE och ( b ) icke-autonoma SINE mobiliserade av AviRTE. SINE: erna består av ett promotorbärande huvud (gult) och en tvåpartssvans som härrör från en del av 5 ′ UTR (blå) och hela 3 ′ UTR (röd). Typiska RNA-polymeras III-transkriberade SINEs 21 identifierades inom suboscine passerines, där manakin- och tyrantflygfångstlinjerna delar ManaSINE1 med tRNA-Glu-härledda promotorer, medan antbird-linjen uppvisar GymnSINE med 5S-rRNA-gen-härledda promotorer. Vidare upptäckte vi två uppkomst av potentiella SINE med ett GC-rikt huvud inklusive ett 5 including-GGCCCCGG-3 ′ motiv som ett potentiellt proteinbindande ställe 62 ; en i hornbill-linjen (BuceSINE) och en i manakin-linjen (ManaSINE2). En annan speciell SINE, MeloSINE, dök upp i den undulatiska linjen och uppvisar ett huvud härrörande från 3'-delen av 28S-rRNA-genen, en konfiguration som liknar en ny SINE nyligen upptäckt hos däggdjur 63 . ( c ) Filogeni (RAxML, GTRCAT-modell, 1 000 bootstrap-replikeringar, bootstrap-värden 50% visas) av 370 nukleotidkonsensussekvenser från superfamily RTE (inkl. AviRTE och ytterligare BLASTN-hits) antyder att AviRTE (rött) är avlägset relaterat till BovB ( orange) och närmare relaterade till RTE: er från vattenlevande djur. RTE-underfamiljer finns i gröna bokstäver för krokodilier och sköldpaddor, i ljusblå bokstäver för andra vattenlevande ryggradsdjur och i mörkblått för vattenlevande ryggradslösa djur. En färgkodad fördelning av värdtaxa över hela RTE-fylogeni visas i tilläggsfigur Fig. 1.

Bild i full storlek

Horisontell transposonöverföring mellan fåglar och nematoder

Vi upptäckte autonoma kopior av AviRTE i sju monofyletiska kladdar av fåglar och två kladdar av nematoder, men inte deras respektive systergrupper (kompletterande data 1), vilket ger de första bevisen för HT hos fåglar och filariala nemoder 20 Kopieringsnummer sträcker sig från 141 till 8 306 kopior i fågel och 273 till 859 kopior i nematodgenom (kompletterande data 1–2). När det var möjligt rekonstruerade vi respektive konsensussekvens, vilket avslöjade ett genomsnittligt totalt nukleotidavstånd på 0, 011 substitutioner per plats mellan fullängds konsensussekvenser härledda från fågel- och nematodgener (tabell 1) Likheten med hög sekvens är inte begränsad till den 3, 2 kb långa öppna läsramen, men är också närvarande över de 5 'och 3' otranslaterade regionerna (UTR: er) som är and 800 bp respektive ∼ 40 bp i storlek. Noterbart upptäckte vi också bevis för parallell utveckling (kompletterande fig. 4) av icke-autonoma, korta ispedd element (SINE) som mobiliseras av den enzymatiska maskinen från AviRTE LINEs (fig. 1b, kompletterande data 1). Alla dessa SINE-delar delar en bipartit-svans som består av fragment av 5 'och 3' UTR: er av AviRTE (fig. 1b), men har ändå olika promotor-bärande huvuden (se legenden om fig. 1b). Sammantaget är mångfalden av icke-autonoma element mobiliserade av AviRTE resultatet av avstamningsspecifika SINE-uppkomst (kompletterande figur 4) och överträffar den kända mångfalden av SINE som mobiliseras av den avlägsna släkt BovB-familjen 21 .

Full storlek bord

Distribution och tidpunkt för transposoninvasioner

Vi studerade sedan fylogenetisk fördelning och temporär aktivitet av AviRTE retrotransposition över en daterad genomskala fylogeni av fåglar 22 . Av de 48 viktiga fågelrepresentanterna som provtagits i denna fylogeni, är AviRTE närvarande i 7 linjer som sträcker sig över bredden av fågelns biologiska mångfald (fig. 2a). Den relativt låga sekvensdivergensen mellan kopior (fig. 2b) och frånvaron från utgruppsgenom av någon sekvens med till och med den minsta likheten med AviRTE (kompletterande data 1) tyder på att denna TE-familj förvärvades via HTs långt efter Neoaves-strålningen vid krita –Palogengräns 22 (Fig. 2a). Med tanke på bevis för mycket nyligen genomförd AviRTE-retrotransposition hos vissa fåglar (till exempel hornbill; fig. 2b), analyserade vi alla genom för närvaro av AviRTE-kopior i full längd och identifierade noll till sex av sådana element per genom (kompletterande data 1) . Alla dessa kopior uppvisar emellertid flera bildskifter och för tidiga stoppkodoner (kompletterande data 3), vilket tyder på att det inte finns några intakta 'mastergener' av AviRTE i de samplade genomgenheterna.

Image

( a ) Filogenetisk fördelning av AviRTE kartlagt på förenklade kronogram av alla större fågelklader (högt rankade namn med grå bokstäver) 22 och en underfil av filarala nematoder 27 . Tillsammans med våra datum för AviRTE-retrotranspositioneringsaktiviteter, avslöjar detta att HT-händelser (röda eller lila streckade cirklar som anger minimi- och maxuppskattningar) inträffade långt efter respektive tidiga diversifiering av Neoaves och filarial nematoder, förmodligen i en Oligocenvåg (orange) och en Miocen våg (gul). Datum för AviRTE-retrotransposition är antingen baserat på en linjespecifik substitutionsgrad av fyrfaldiga degenererade platser från respektive fågel 13 (röd färg) eller en neutral substitutionsgrad från nematoden Pristionchus pacificus 23 (lila färg). Som jämförelse är HT-datum baserade på den genomsnittliga neutrala substitutionsgraden från Caenorhabditis spp. 26 visas också (grå streckade cirklar). Minsta uppskattningar för genominvasioner och extinktioner är respektive start- och slutpunkter för röda respektive lila linjer, och motsvarar 95% -intervallet för AviRTE-retrotranspositioneringsaktivitet mätt i skalan av parvis divergens till konsensus (Kompletterande data 2). Dessutom visas 99% -intervall (ljusröda eller ljuslila linjer) som maximala uppskattningar för genominvasioner och utrotningar och genomsnittsaktivitet (kryssmärke). ( b, c ), Landskapsdiagram av AviRTE-divergens (röd; sammobiliserade SINE i blått) i ( b ) fågel- och ( c ) nematodgenom illustrerar per-genom retrotranspositionell aktivitet på en relativ tidsaxel. Fågelplanen är i samma ordning som motsvarande taxa i fågelfilogenen i panel a . Vi noterar att alla nematoder AviRTE-tomter utom den av Loa loa är mycket lika med avseende på kopienummer (Kompletterande data 1) och medelavvikelser (Kompletterande data 2), eventuellt till följd av en enda TE-invasion av kärngenomen i Brugia / Wuchereria förfader.

Bild i full storlek

Sedan sluts vi konservativt ut minimitider för HT genom att tillämpa linjespecifika substitutionsgrader för sju fågelarter 13 (härledda från daterade grenlängder av motsvarande fylogen 22 ) till den övre gränsen för 95% intervall av avvikelser mellan kopior av AviRTE (se Metoder ). Dessa minimiberäkningar antyder två tillfälligt distinkta invasioner ( t- test, P = 0, 0006), den första vågen> 25, 0 till> 23, 6 Myr sedan bland kolibrier, psittacid papegojor och hornbills (fig. 2a) och den andra vågen> 20, 2 till > 17.7 Myr sedan i tinamös, suboscine passerines, mesites och trogons. I överensstämmelse med hypotesen om HT som involverar nematoder, är de två vågorna av HT i fåglar tillfälligt kompatibla med de datum som sluts ut när man överväger avvikelser per av genom aviRTE-kopior i nematodgener (fig. 2c) under en neutral substitutionsgrad 23 och en generation tid på 90 dagar 24 . Följaktligen dras genom invasioner av genom att ha ägt rum> 21.2 Myr sedan i förfäderna till Brugia spp./ Wuchereria bancrofti , de orsakande medlen för lymfatisk filariasis, och> 16, 8 Myr sedan i förfäderna till Loa loa , det orsakande medlet för loiasis. Till skillnad från de ovan nämnda linjespecifika substitutionsgraden för fåglar, är nematoden HT-datum baserade på den neutrala substitutionsgraden för en mutationsackumuleringslinje från en annan nematod, Pristionchus pacificus 23, eftersom sådana hastigheter inte är tillgängliga för filariala nemoder. Även om Weller et al . 23 föreslog att hastigheten i Pristionchus skulle vara representativ för nematoder, vi betonar att molekylär datering av nematoder är notoriskt svårt på grund av skillnader i livsstil och en praktiskt taget icke-befintlig fossilrekord 25, och våra nematoddatum för AviRTE-överföringar bör därför behandlas med varning. Trots detta antyder dessa nematoder HT-datum och datum härrörande från de något lägre neutrala substitutionsgraden för Caenorhabditis- arter 26 båda tillfälligt distinkta invasioner i Brugia / Wuchereria- linjen och Loa- linjen (Fig. 2a, kompletterande data 2). Vi noterar också att de Pristionchus- baserade minimidatumen är tillfälligt kompatibla med delningen av Brugia / Wuchereria / Loa- linjen från Acanthocheilonema viteae och andra AviRTE-fria utgrupper (fig. 2a, kompletterande data 1) i en oberoende daterad nematodfilogen 27 . Vidare antyder gruppering av HT-datum från Brugia / Wuchereria- linjen i den första och L. loa i den andra av de nämnda vågorna av HT igen att AviRTE-överföringar inträffade i två distinkta skurar ( t- test, P = 0, 0002). De två oberoende genominvasionerna av nematoder är överraskande med tanke på att dessa två linjer är nära besläktade inom filariala nemoder 27, 28, men i överensstämmelse med skillnader mellan formerna för AviRTE-divergenslandskapen i Loa- linjen och Brugia / Wuchereria- linjen (Fig. 2c, kompletterande data 1–2). Slutligen indikerar de mycket korta internoderna i AviRTE-fylogeni en snabb följd av HT i fåglar och nematoder (Fig. 3c), och det finns fylogenetiska bevis på att dessa två skurar av HT är diskreta. Mer exakt bildar AviRTE-underfamilier av den andra vågen en monofyletisk grupp kapslad i den första vågen, och nematoden AviRTEs-gruppen med fågelaviärer av AVIRTE med liknande minsta invasiondatum (fig. 3b).

Image

( a ) Olika geografiska ursprung för sju representanter för AviRTE-bärande fåglar illustrerade på en paleogeografisk karta över jorden för 20 Myr sedan. Mollweide-projektionskartan är copyright för Ronald Blakey (används med tillstånd). ( b ) Paleobiogeografi av AviRTE-fylogeni (se panel c ) sluts genom analys av statistisk dispersal-vicariance (S-DIVA). Vi använde avifaunal regioner sensu Ericson 35 . För noder markerade med en asterisk visas endast de områden som fick> 33% av förfädernas areafördelning på denna nod. Påfallande är de två vågorna av HT-händelser ( jfr. Fig. 2a) inte bara separerade tillfälligt (genom invasionen av de första och andra vågorna av HT visas med orange respektive gula bokstäver), utan också fylogenetiskt och biogeografiskt. ( c ) Arten trädet av fåglar 22 och nematode 27 värdar (vänster) är starkt inkonsekvent med AviRTE-fylogeni (höger; RAxML, GTRCAT-modell, 1 000 bootstrap-replikeringar, bootstrap-värden 50% visas) och antagandet om nio HT-händelser ( röda asterisker) krävs för att förena de två topologierna. AviRTE-fylogeny är rotad till flera mer eller mindre nära besläktade utgrupper (kompletterande fig. 4; se fig. 1c); emellertid visas endast den närmaste utgruppen för jämförbarhet mellan ingruppens internlängder. Gröna grenar är topologiskt identiska mellan båda träden, vilket innebär vertikal överföring i artsrika fåglar. Orange och gula färger indikerar Oligocen- och Miocenvågorna för HT-händelser.

Bild i full storlek

Paleobiogeografin av transposoninvasioner

Även om de fåglar som bär AviRTE-fåglar spänner över hela fågelns livsträd, är det slående att alla dessa främst förekommer i tropiska regioner 29 . De inkluderar typiska neotropiska avifauna såsom kolibrier och tinamous, Madagaskas endemiska mesiter och medlemmar i mer utbredda tropiska fågelmonteringar (fig. 3a, b). Det noterades nyligen att genomskalig datering av fåglar ger mycket lägre divergensberäkningar än andra molekylära studier 22, 30, 31, vilket förklarar varför våra utdragna fågel HT-datum efter datum, till exempel tidigare datum för diversifiering av suboscine passerines 32 och psittacid papegojor 33 . Oavsett detta avvikelse mellan absoluta datum tyder emellertid vår täta avgiftssampling på att HT förekom i respektive förfäder till Psittacidae (psittacid papegojor), Suboscines (suboscine passerines) och Trochilidae (kolibrier); och potentiellt Bucerotidae (hornbills), Mesitornithidae (mesites), Tinamidae (tinamous) och Trogonidae (trogons) (Kompletterande data 1, Fig. 3c). Dessa relativa datum föregår början av linjespecifik diversifiering och möjliggör således paleobiogeografiska slutsatser. Vi rekonstruerade de förfäderna områdena av HT genom att anta en pantropisk fördelning av filariala nemoder och överväga befintliga bevis för paleobiogeografin i respektive fågelblock. Passeriner och papegojor är närmare besläktade än tidigare trott 22, 34 och diversifierade i Australasia 33, 35 (men se ref. 30). Emellertid har suboscine passerines troligen sitt ursprung i Neotropics 30, 32, medan det biogeografiska ursprunget till hornbills och trogons är okänt 35 . Vi finner att ett neotropiskt ursprung för AviRTE är troligt med tanke på den djupa greningen av kolibrier i AviRTE-fylogeni (fig. 3b), och att resten av den första vågen av HT (fig. 2a) inträffade över alla tropiska regioner utom Madagaskar (se Metoder och kompletterande fig. 5 för geografiskt mindre begränsade analyser). Däremot inkluderar den andra vågen av HT (fig. 2a) Madagaskar och ägde huvudsakligen rum i Neotropics. Sammantaget antyder dessa resultat att paleobiogeografin av AviRTE-överföringar skedde i en global, pantropisk skala. Det är vidare värt att notera att de respektive fylogenetiska positionerna för AviRTEs från Brugia spp./ W. bancrofti och L. loa sammanfaller med de ovannämnda temporära likheterna i invasionen av genom. Vi föreslår därför att förfäderna till Brugia / Wuchereria var involverade i den första skuren av AviRTE-överföringar, medan Loa- förfäderna var en del av den andra vågen av HT. Dessutom antyder direkt jämförelse av värdartsträdet med AviRTE-trädet (fig. 3c) att skillnaderna i fylogenetisk topologi förklaras mest nådigt av nio HT-händelser. TE-relationerna i kolibrier, psittacida papegojor och suboscine passerines verkar emellertid vara ett resultat av vertikalt arv respektive, vilket antyder att AviRTE formade genomutvecklingen av dessa artrika linjer genom uthållighet av retrotranspositionell aktivitet över deras diversifieringar (Kompletterande data 2) .

Möjliga vektorer för HT

Denna studie är den första som rapporterar HT om TE-grupper som involverar genomfåglar från fåglar eller filariala nemoder. Våra resultat ger fylogenetiska, paleobiogeografiska och temporära bevis på att de endoparasitiska Brugia / Wuchereria och Loa- linjerna var var och en involverade i AviRTE-överföring. Dessa nematoder har för närvarande en nästan pantropisk fördelning och överförs av mygg 14, 27 respektive hjortflugor 16 . Även om de flesta fåglar kan flyga, har deras spridning historiskt sett varit begränsad över avifaunal gränser, särskilt i tropikerna 29, 35 . Vi föreslår därför att de två skurarna av pantropiska utbyten av AviRTE mellan fem avifaunalregioner katalyserades av den pantropiska spridningspotentialen hos filarala nematoder via deras dipteranvektorer. Även om det kan tänkas att AviRTE-överföring skedde direkt från blodsugande dipteraner till fåglar, finner vi att AviRTE är frånvarande från tillgängliga dipterangenes-sekvenser 19 och endoparasitisk interaktion mellan insektsburna nematoder och fåglar kan vara en mer trovärdig plattform för en sådan utbredd HT. Oavsett makroskopiska vektorer för HT förblir det emellertid mystiskt hur exakt TEs rör sig från ett könsgenom till ett annat, där potentiella kandidater är nakna RNA eller virus 8 . Alternativt är intracellulära Wolbachia- bakterier plausibla cellgenomträngande vektorer 8 och infekterar många filariala nemoder, men de saknas ändå i L. loa 16 . Det är vidare värt att notera att framgångsrik HT är mycket mer komplex än bara infiltrering av en ny värdcell med transposon-DNA eller retrotransposon RNA. För att förfäder överförda AviRTE ska vara synliga i befintliga genom, måste ett retrotransposon-RNA i full längd kolonisera ett nytt grovgenom, retrotransposera in i en genomisk miljö som tillåter retrotranspositionell aktivitet som en intakt AviRTE-"mastergen" och driva till fixering i värdpopulationen . Det är därför troligt att de nio händelserna med framgångsrik infiltration av HT och groddlinje, som rekonstruerats här från dussintals samplade djurgenom, endast är en liten bråkdel av det faktiska antalet förhistoriska AviRTE-utbyten mellan fåglar och filariala nemoder.

Diskussion

Vår studie stöder uppfattningen att interaktioner mellan värd och endoparasit är benägna att episodiskt genutbyte, inklusive "själviska gener" som AviRTE och andra TE, en process som vidarebefordrar genetiskt material som "offentliga varor" 36 bland icke-relaterade organismer. Vi visar att HT: er vittnar om långa utrotade organisminteraktioner mellan fåglar och nematoder, även om det förblir obestämd om interaktionerna som ledde till fågel-nematod HT: er var direkt eller indirekt. De orsakande medlen för lymfatisk filarias och loiasis infekterar människor som deras vuxna värd 14, 16 och många andra filariala nemoder är kända för att endast infektera däggdjur, möjligen resultatet av ett förfäder däggdjursvärd 27 . Avsaknaden av AviRTE i däggdjursgener trots omfattande fågel-nematod HT verkar utmana denna uppfattning. HT: s två vågor sträckte sig över livets fågelsträd och involverade snabb rörelse bland alla fem tropiska regionerna i tropikerna, vilket är förbryllande med tanke på att tropiska jordbruksföretag har begränsade benägenheter för interkontinentalt spridning 35 . Vi antar alltså att linjerna Brugia / Wuchereria och Loa var Oligocene / Miocen-parasiter av tropiska fåglar och spridda pantropiskt genom sina dipteranvektorer. Detta kan förklara ovannämnda komplexa paleobiogeografi av HT: er. Ett sådant scenario kräver att nematodlinjerna genomgick två efterföljande värdomkopplare till människor eller deras hominida förfäder, troligen efter att AviRTE upphörde retrotranspositionell aktivitet i filariala nematoder och därmed förlorat sin potential för HT till hominidgener. Våra indirekta bevis för forntida interaktioner mellan fåglar och förfäderna till de orsakande medlen för lymfatisk filariasis och loiasis väcker möjligheten att dessa utbredda mänskliga patogener kan ha oberoende utvecklats från förhistoriskt allestädes närvarande fågelendoparasiter. Vi räknar med att utforska den försummade biologiska mångfalden hos befintliga fågelinfekterande nematoder kommer att ge ytterligare stöd till denna hypotes.

metoder

I silico- screening

Vi upptäckte ursprungligen en förmodligen RTE-mobiliserad SINE (senare benämnd 'ManaSINE1') i RAD-sekvenser av en Neotropical Zimmerius flucatcher 37 . SINE-sekvensen var BLASTN 38 som sökte mot ett budgerigar 39- repeteringsbibliotek som vi hade genererat de novo med hjälp av Repeatmodeler version 1.0.5 (//www.repeatmasker.org/RepeatModeler.html). Detta ledde till upptäckten av en nästan full konsolvenssekvens för en autonom RTE som vi betecknade 'AviRTE'. Vi använde sedan budgerigar AviRTE-fragmentet som fråga för alla efterföljande BLASTN-skärmar (cutoff e- värde 1e – 10) av djurgenomförsamlingar och nukleotidsekvenser tillgängliga i GenBank 40, inklusive genomerna av 48 fåglar 13 och 2 ytterligare papegojor 41, 42 . Dessutom omfattade våra screeningar alla insekts- och fästgenom i VectorBase 19, och alla filarala nematodgener i WormBase 15, 17 . Vi såg till att vi för varje fågel- och nematodklader som visade AviRTE, också provade de närmaste släktingarna som utgrupper (Kompletterande data 1).

In vitro- screening

Våra taxonprover kompletterades med arter där genom- eller undersökningssekvenser inte var tillgängliga (Kompletterande data 1). Vi samplade dessa med hjälp av en kort PCR som förstärker en 126-bp-region från den bevarade 5 ′ UTR för AviRTE. PCR-parametrar var 40 cykler 94 ° C under 20 s, 53 ° C under 45 s och 68 ° C under 60 s, följt av slutlig töjning under 120 s vid 68 ° C. Vi använde primrarna AviRTEint-F / R (5′- CCTGAGGACTTCACTGTCACC -3 ′ + 5′- CTTCAAGCCTGTGCAGTGG -3 ′) och tolkade frånvaron av en amplikon som en indikation på genomisk frånvaro av AviRTE (kompletterande figur 3). När det gäller Pitta moluccensis bekräftade vi dessutom AviRTE-närvaron genom direkt Sanger-sekvensering av PCR-amplikonet (kompletterande data 4). Slutligen kunde vi förstärka den fulla längden på AviRTE i Gymnopithys rufigula med fyra överlappande PCR-amplikoner och efterföljande Sanger-sekvensering av fyra kloner per amplikon, vilket möjliggjorde generering av en konsensus-sekvens. PCR-parametrar var en initial denaturering under 120 s vid 94 ° C, 35 cykler av 94 ° C under 30 s, 50/54 ° C under 30 s och 72 ° C under 80 s, följt av slutlig töjning under 300 s vid 72 ° C. Renade PCR-produkter klonades in i Escherichia coli JM09-celler med användning av pGEM-T Vector följt av PCR-amplifiering via standard M13-primrar. De fyra primerparen var AviRTEfull-1F / R (5'- TCGTGGGGAAAGAGCTTG -3 '+ 5′- AATACAATCGGAATGACCTGTC -3'), AviRTEfull-2F / R (5'-AGGCATCTCTCAGGAGTTGG -3 ′ + 5TCCTCATG), AviRTEfull-3F / R (5′- CAAGTGGTGGATCAACCTAGC -3 ′ + 5′- TGATTTAGGGTCTTGGTGTGG -3 ′), och AviRTEfull-4F / R (5′-CCTATTCAATCTAAGGCGACTG -3 ′ + 5ATGCTTC)

Sekvensering av helgenomundersökning

Vi erhöll undersökningssekvenser av hela genom via parvis slutning på Illumina HiSeq 2000-plattformen (100 bp läsningar). Insatsstorleken var 300 bp och den slutliga täckningen ∼ 6 × för de två suboscinesna. För de tre kolibrierna varierade skärstorlekarna från 275 till 450 bp och den slutliga täckningen var 0, 1 ×. Genomisk närvaro av AviRTE fastställdes av BLASTN-skärmar (avstängning e- värde 1e – 10). När det gäller Oreotrochilus melanogaster och Zimmerius-krysopor kunde vi dra slutsatser om fullständiga respektive nästan fullständiga AviRTE-konsensussekvenser.

Konsensus sekvenser

Konsensussekvenser för majoritetsregel genererades manuellt från varje AviRTE-bärande värdgenomförsamling. Vi använde standardförfaranden 43, 44 för att rekonstruera AviRTE: er i full längd via BLASTN och förlängning genom re-BLASTN-sökningar för att övervinna ofullständiga 5 'och 3' ändar. För var och en av dessa flera omgångar med BLASTN-sökningar konstruerades flera sekvensjusteringar av BLASTN-träffar med användning av MAFFT 45, 46 version 7 (E-INS-i, //mafft.cbrc.jp/alignment/server/index.html). De resulterande konsensussekvenserna sträcker sig över hela AviRTE eller co-mobiliserade SINE, i sällsynta fall med "N" -nukleotider i tvetydiga regioner som motstått rekonstruktion. Konsekvenssekvenser i full längd av AviRTEs och co-mobiliserade SINE överlämnades till Repbase (//www.girinst.org/repbase/index.html) (se även kompletterande data 5).

Filogenetiska analyser

Vi justerade automatiskt konsensussekvenser med hjälp av MAFFT och sedan manuellt anpassade tvetydiga regioner. För AviRTE-fylogenierna (fig. 3c, kompletterande fig. 4) var detta tillräckligt för att generera nukleotidsekvensinriktningar över hela AviRTE-längden (kompletterande data 6). Å andra sidan innehöll nukleotidsekvensinriktningen för fylogeni av alla RTE-subfamilier som finns i RepBase, ytterligare GenBank BLASTn-träffar och alla AviRTE-subfamilier (fig. 1c, kompletterande fig. 1) många oklarheter och dåligt anpassade regioner som togs bort med användning av Gblocks 47 version 0.91b. Vi valde standardparametrar i Gblocks webbserver (//molevol.cmima.csic.es/castresana/Gblocks_server.html) för mindre stränga val av justeringspositioner (det vill säga mindre slutblock, gapspositioner i de slutliga blocken, mindre strikt flankering positioner), vilket ger en 429-bp hög säkerhetsinriktning (kompletterande data 7) från den ursprungliga 23 637 bp. Observera att det låga antalet kvarhållna inriktningspositioner återspeglar det faktum att mycket avlägsna RTE-underfamilier inkluderades, såsom de från angiospermväxter. Vi uteslutte sekvenser som justerade sig dåligt vid nukleotidnivån eller innefattade <200 bp av den filtrerade inriktningen, vilket reducerade den totala mängden sekvenser i RTE-superfamilieinriktningen från 444 till 370. Vi genomförde sedan alla fylogenetiska analyser under maximal sannolikhet i RAxML 48 version 8.1 .11 (GTRCAT-modell, 1 000 slutsatser för slutsteg) på CIPRES Science Gateway 49 (//www.phylo.org/portal2/login!input.action). Alla fylogenetiska träd finns i Newick-format (Kompletterande data 8).

Distans- och dateringsanalyser

Parvisa nukleotidavstånd mellan AviRTE-konsensussekvenser (tabell 1) beräknades i MEGA6 (ref. 50) under Kimura 2-parametermodellen 51 med enhetliga hastigheter bland platser och parvis borttagning av luckor / saknade data.

Vi kommenterade sedan de genomiska kopiorna av AviRTE med RepeatMasker version 3.3.0 (//www.repeatmasker.org/RMDownload.html) med ett anpassat repetitionsbibliotek för var och en av de AviRTE-bärande genomenheterna. Detta bibliotek innehöll den samspecifika AviRTE-konsensus (och, om närvarande, sam-mobiliserade SINE-konsensussekvenser). I de fall där denna sekvens var ofullständig och innehöll "N" -rester, använde vi istället konsensussekvensen i full längd från det mest besläktade värdgenomet. Vi beräknade därefter avstånd per kopia till konsensus i calcDivergenceFromAlign.pl-skriptet som ingår i RepeatMasker-programpaketet (Kimura 2-parametermodell, exklusive CpG-webbplatser) och ritade dessa som AviRTE-divergenslandskap (Fig. 2b, c). En sådan divergensfördelning återspeglar retrotranspositioneringsaktiviteten för AviRTE på en relativ tidsskala per genom. Vi antar emellertid att dess extrema med hög divergens och låg divergens, som vanligtvis endast innehåller <100 bp per divergensfack (kompletterande data 2), i själva verket kan uppstå från genomiska outliers i substitutionsgrader, såsom bevarade eller hypervariabla regioner. Dessutom är det troligt att några av de mycket korta AviRTE-fragmenten med hög divergens resulterar från falska träffar till slumpmässig icke-AviRTE-sekvens under den BLAST-baserade RepeatMasker-kommentaren. We therefore considered the boundaries of 95% of the distribution as suitable conservative estimates for the onset (latest point of genome invasion) and end (earliest point of extinction) of AviRTE retrotransposition, and the 99% interval as the maximum duration (Supplementary Data 2). Absolute dates were inferred by dividing these divergence values by two times the substitution rate (see Supplementary Data 2 for more details). For the seven birds, we used the fourfold degenerate site substitution rate derived from the respective bird genome 13, 52 . Given the lack of substitution rates from filarial nematodes, we considered the neutral substitution rates of different nematodes, P. pacificus 23 and Caenorhabditis species 26, under the assumption of a generation time of 90 days for filarial nematodes 24 . Finally, we plotted the inferred AviRTE retrotranspositional activities on the dated genome-scale tree from the study by Jarvis et al . 22, 53 (Fig. 2a).

Biogeographic analyses

We used the S-DIVA method 54 for biogeographic reconstruction of the site of HT occurrence under the assumption that extant bird species usually occur in less than two avifaunal regions 35 . Thus, analyses were done in RASP 55 using standard parameters and allowing a maximum of two areas per node. Given the current cosmopolitan distribution of nematodes and their great age compared with birds 56, we assumed a pantropical distribution of the Loa and Brugia / Wuchereria lineages at the time of HT. For birds, we considered existing evidence for the paleobiogeography of the respective avian clades to infer the areas each lineage inhabited at the time of the HT of AviRTE. Because there is no certainty about the paleobiogeography of each avian lineage, we carried out three different analyses at various levels of conservatism to infer the main location of HT.

First, we considered the widest possible distribution of each bird lineage at the time of HT (Supplementary Fig. 5a). In the absence of a detailed avian fossil record 57, this meant that the area of occurrence of most bird lineages would be equated to their present-day distribution, such as hummingbirds (Trochilidae) in the Neotropics; psittacid parrots (Psittacidae) in Australasia, Africa, Indomalaya and the Neotropics; tinamous (Tinamidae) in the Neotropics; mesites (Mesitornithidae) in Madagascar; and trogons (Trogonidae) in Africa, Indomalaya and the Neotropics. We made an exception for the paleotropical hornbills (Bucerotidae) and the pantropical suboscine passerines (Suboscines): both lineages occur in Australasia, but do so only marginally with one and five species, respectively, all of which are known to be of fairly recent Indomalayan descent 58, 59 . Therefore, hornbills were only coded for Africa and Indomalaya, whereas suboscines were only coded for Africa, Indomalaya and the Neotropics in this analysis.

Second, we repeated the first analysis but additionally included areas in which lineages may no longer be present now but are thought to have occurred around the time of HT based on the fossil record (Supplementary Fig. 5b). Given the poor avian fossil record 57, this only changed the area designation for a single lineage, the hummingbirds, which are presently distributed only in the New World 60 but are known from early-Oligocene Old World fossils 61 . Hence, in this analysis we coded hummingbirds for the Neotropics, Africa and Indomalaya.

Finally, in our main analysis (Fig. 3b) we only included regions thought to be the areas of occurrence of each respective bird clade roughly at the time of HT based on the current literature. For lineages in which the area of occurrence at the time of HT could not be further narrowed down in comparison to present-day distribution (that is trogons, mesites, tinamous, hornbills and hummingbirds), the same areas as in the first analysis (Supplementary Fig. 5a) were used. However, for psittacid parrots (Psittacidae), we used Australasia as the area of occurrence based on two considerations: (i) there is ample phylogenetic evidence on the Australasian origin of most deep parrot lineages 33, 35 ; and (ii) the internal topology of psittacid AviRTE subfamilies strongly suggests that the HT occurred into the last common ancestor of Psittacidae before the divergence of this family into Neotropical, African and Australasian clades. In the same way, we used the Neotropics as the area of occurrence for suboscines based on two similar considerations: (i) the Neotropics are the most likely ancestral area of suboscines 35, 58 ; and (ii) the internal topology of suboscine AviRTE subfamilies, as well as their presence in both major suboscine clades strongly suggest that the HT occurred into their last common ancestor before the break-up into Old World and New World suboscines.

anslutningar

Sequence Read Archive

  • SRS1259545
  • SRS1259546
  • SRS1303252
  • SRS1303254

Kompletterande information

PDF-filer

  1. 1.

    Kompletterande information

    Supplementary Figures 1-5 and Supplementary References.

Excel-filer

  1. 1.

    Kompletterande data 1

    Taxon sampling of birds and nematodes used for the detection of AviRTE.

  2. 2.

    Kompletterande data 2

    Activity periods of AviRTE derived from per-copy distances in bird and nematode genomes.

Textfiler

  1. 1.

    Kompletterande data 3

    Amino acid alignment of AviRTE ORF from subfamily consensus sequences and single full-length copies. In addition to premature stop codons, all of the single full-length copies contain frameshifts, which was compensated by the insertion of alignment gaps prior to ORF translation.

  2. 2.

    Kompletterande data 4

    Alignment of the AviRTE 5' UTR region amplified by short PCR. Primer sequences and the Old World suboscine Pitta moluccensis are included.

  3. 3.

    Kompletterande data 5

    Fasta-formatted consensus sequences of AviRTE subfamilies and co-mobilized SINEs.

  4. 4.

    Kompletterande data 6

    Nucleotide sequence alignment of AviRTE subfamilies, co-mobilized SINEs, and selected RTE outgroups. This alignment was used for phylogenetic analyses shown in Supplementary Fig. 4 and, after exclusion of SINEs, in Fig. 3c.

  5. 5.

    Kompletterande data 7

    Nucleotide sequence alignment of AviRTE subfamilies, all RTE families present in RepBase, and additional GenBank BLASTn hits. This alignment was used for the phylogenetic analysis shown in Fig. 1c and Supplementary Fig. 1.

  6. 6.

    Kompletterande data 8

    Newick-formatted phylogenetic trees from (a) Fig. 1c and Supplementary Fig. 1, (b) Fig. 3c, and (c) Supplementary Fig. 4.

kommentarer

Genom att skicka en kommentar samtycker du till att följa våra villkor och gemenskapsriktlinjer. Om du finner något missbruk eller som inte överensstämmer med våra villkor eller riktlinjer ska du markera det som olämpligt.