Allosterisk hämning av inducerbar hypoxi-faktor 2 med små molekyler | natur kemisk biologi

Allosterisk hämning av inducerbar hypoxi-faktor 2 med små molekyler | natur kemisk biologi

Anonim

ämnen

  • Biokemi
  • Biofysik
  • cancer
  • Kemiska verktyg
  • Screening med hög kapacitet
  • Små molekyler

Abstrakt

Hypoxiainducerbara faktorer (HIF) är heterodimera transkriptionsfaktorer inducerade i många cancerformer där de ofta främjar uttrycket av protumorigena vägar. Även om transkriptionsfaktorer vanligtvis betraktas som "icke-brytbara", innehåller PAS-B-domänen i HIF-2a-underenheten ett stort hålrum inom dess hydrofoba kärna som erbjuder ett unikt fotfäste för små molekylregleringar. Här identifierar vi konstgjorda ligander som binds i denna ficka och karakteriserar de resulterande strukturella och funktionella förändringarna som orsakas av bindning. Noterbart antagoniserar dessa ligander HIF-2-heterodimerisering och DNA-bindande aktivitet in vitro och i odlade celler, vilket reducerar HIF-2-målgenuttryck. Trots den höga sekvensidentiteten mellan HIF-2a och HIF-la, är dessa ligander mycket selektiva och påverkar inte HIF-1-funktionen. Dessa kemiska verktyg skapar den molekylära basen för selektiv reglering av HIF-2, vilket ger potentiella terapeutiska möjligheter att ingripa i HIF-2-driven tumörer, såsom njurcellscancer.

  • Förening C12H6CIN5O5

    N - (4-kloro-3-nitrofenyl) -4-nitrobenso [ c ] [1, 2, 5] oxadiazol-5-amin

  • Förening C12H6ClFN403

    N - (3-kloro-5-fluorfenyl) -4-nitrobenso [ c ] [1, 2, 5] oxadiazol-5-amin

Huvudsaklig

Mänskliga celler svarar på hypoxi genom de samordnade åtgärderna från HIF-familjen av transkriptionsfaktorer 1 . Samlade som heterodimerer av en syrekänslig underenhet (HIF-la, HIF-2a eller HIF-3a) och en dimeriseringspartner (arylkolväteceptorkärntranslokator (ARNT) eller HIF-p), kontrollerar dessa proteiner uttrycket av hundratals gener som underlättar cellulär anpassning och svar på 2, 3 med låg syre. Även om HIF: er utför kritiska fysiologiska funktioner 1, 4, 5, är ökade mängder av dessa potenta faktorer starkt korrelerade med uppkomsten och utvecklingen av olika cancerformer 1 . Faktum är att flera nedströmsmål för HIF är väl validerade mål för cancerbehandlingar. Det finns emellertid potentiellt anmärkningsvärda fördelar med att direkt motverka HIF-komplexen själva, och följaktligen deras många nedströmsmål, som stöds av experiment som kopplar HIF-ablation till nedsatt tumörgenes 6, 7, 8 . Som sådant finns det ett starkt intresse för utvecklingen av konstgjorda föreningar för att reglera HIF-funktion, att generera både grundläggande forskningsreagens och blyföreningar för terapeutisk utveckling.

HIF presenterar emellertid ett traditionellt utmanande mål för farmakologisk ingripande: det är ett stort, intracellulärt proteinkomplex utan några aktiva ställen, som vanligtvis används för substratbinding av små molekyler. Dessutom ligger mycket av transkriptionsfaktorn främst i en utökad konformation, vilket ytterligare reducerar tillgängligheten för potentiella ligandbindningsställen. Båda HIF-subenheterna innehåller emellertid Per-ARNT-Sim (PAS) protein-proteininteraktionsdomäner som bidrar till sammansättningen av HIF-komplexet 9, 10 och rekryteringen av koaktivatorer 11, 12 . Dessa PAS-domäner används i stor utsträckning som miljöavkännare genom hela biologin, och kontrollerar aktiviteter för en mängd olika proteiner 13 . Speciellt uppnås sådan miljöavkänning ofta genom att binda små molekylära kofaktorer inom kärnan i ett PAS-domän, med användning av ligandinducerade allosteriska förändringar för att kontrollera affiniteten för andra proteinelement bundna till utsidan 14 . Med tanke på svårigheterna med att direkt och selektivt antagonisera protein-protein-interaktioner med små molekyler 15, 16 erbjuder utnyttjande av sådana inre håligheter potentiella fördelar.

PAS-B-domänen från HIF-2a verkar vara särskilt mottaglig för ligandförmedlad allosterisk reglering. Denna speciella PAS-domän innehåller ett relativt stort (290 Å 3 ) förformat hålrum som kan ockuperas av antingen vatten eller små molekyler 17, 18 . Med användning av NMR-baserade skärmar med små fragmentbibliotek visade vi tidigare att denna plats kan vara bunden av små molekylligander med submikromolära affiniteter, vilket inducerar konformationella förändringar som försämrar heterodimerisering av isolerade PAS-B-domäner in vitro 18 . Tyvärr var dessa molekyler inte själva lämpliga för ytterligare karaktärisering i odlade celler, vilket ledde till att vi använde en funktionsbaserad hög genomströmningsskärm för att kartlägga ett större bibliotek med mer komplexa föreningar för hämmare som kan störa en konstruerad HIF-2 PAS-B heterodimer .

Här framskrider vi väsentligt dessa studier via utvecklingen av ett förbättrat ställning för små molekyler som ursprungligen identifierades på denna skärm. Biofysisk karakterisering av dessa föreningar och ett derivat optimerat med läkemedelskemiska tillvägagångssätt demonstrerar specifik, selektiv och effektiv bindning i den inre kaviteten i HIF-2a PAS-B. Dessa föreningar stör heterodimerisering av HIF-2-transkriptionsfaktorn i full längd. Det är anmärkningsvärt att dessa molekyler fungerar effektivt som HIF-2-hämmare i levande celler, vilket stör HIF-2-DNA-bindning och transkriptionen av dess målgener. Dessutom är dessa föreningar selektiva för HIF-2-isoformen och misslyckas med att motverka HIF-1, vars högt besläktade HIF-la-underenhet saknar ett jämförbart ligandbindande ställe. Dessa reagens tillhandahåller en möjlighet att avgränsa skillnader i HIF-1 och HIF-2-fysiologi och fungerar som en utgångspunkt för eventuell selektiv terapeutisk inaktivering av HIF-2 vid sjukdomar 19, inklusive njurcellscarcinom 20, 21, 22 .

Resultat

Identifiering av HIF-2 PAS-B-dimeriseringsantagonister

Vi identifierade tidigare ligander som binder HIF-2a PAS-B-domänen med användning av lösning-NMR-baserad screening av ett litet bibliotek med nästan 800 läkemedelsliknande fragment 17, 18, 23 . Efter optimering av medicinsk kemi, bundna vissa avancerade blyföreningar HIF-2a med submikromolära dissociationskonstanter. Trots sin stora storlek (molekylvikt ∼ 300 Da), alla dessa ligander bundna i en inre ficka (290 Å 3 ) helt begravda inom HIF-2a PAS-B-domänen 17, 18 . Kaviteter av denna storlek eller större är ganska sällsynta och finns i endast ∼ 0, 3% av över 32 000 högupplösta strukturer av proteiner eller proteindomäner med jämförbara storlekar (kompletterande resultat, kompletterande figur 1). Nästan alla dessa håligheter utgör ligandbindande ställen inom apo-formerna av naturliga ligandbindande proteiner. I överensstämmelse med en jämförbar funktionell roll för kaviteten i HIF-2a PAS-B, visade våra konstgjorda ligander blygsamma förmågor att störa isolerade PAS-PAS-interaktioner in vitro 18 . Emellertid begränsade deras begränsade styrka att göra detta ytterligare karakterisering i levande celler.

För att identifiera överlägsna kemiska ställningar med potential att motverka HIF-2-aktivitet i levande celler, utvecklade vi en in vitro- analys som bedömde funktionell störning av PAS-PAS-interaktioner i ett HTS-format (High -putput screening). De isolerade vildtypsdomänerna associeras med KD ∼ 100 μM, vilket utesluter många protein-proteininteraktionsanalyser. Denna interaktion kan förbättras med mer än 100 gånger genom att introducera mutationer som förbättrar joniska interaktioner vid det komplexa gränssnittet utan att förändra andra PAS-funktioner, inklusive HIF-2a-ligandbindningsstället 18 . Dessa "PAS-B *" -varianter (HIF-2a R247E och ARNT E362R ) användes i en amplifierad luminescerande närhetshomogen analys (AlphaScreen) för att identifiera föreningar som kan störa den stabiliserade heterodimeren (kompletterande fig. 2).

Med användning av denna HTS-analys undersöktes över 200 000 föreningar individuellt för deras förmåga att störa HIF-2a – ARNT PAS-B * -komplexet (kompletterande tabell 1). De översta 640 "hit" -föreningarna, som var och en minskade luminescens närhetssignalen med över 3 ^, analyserades om. Cirka 80% av dessa initiala träffar validerades, vilket återspeglar den höga kvaliteten på denna skärm. Ett stort antal av dessa bekräftade träffar antagoniserade emellertid en nyckelräkneskärm utformad för att eliminera föreningar som stör själva AlphaScreen-formatet. När dessa icke-specifika föreningar eliminerats förblev färre än 70 kandidatstörningar av HIF-2a – ARNT PAS-B * heterodimer. Efterföljande titreringar av en återuppfylld undergrupp av dessa föreningar avslöjade flera föreningar med standarddosberoende beteende, med halv-maximal effektiv koncentration (IC50) -värden som sträcker sig mellan 0, 3 μM och 10 μM, såsom exemplifieras för förening 1 (kompletterande figur 3a, b ). Noterbart delade denna klass av föreningar vissa strukturella särdrag med aminlänkade föreningar identifierade från våra NMR-baserade ligandbindningsskärmar 17, 18, vilket ledde till att vi ytterligare undersöker deras arbetssätt och styrka.

I princip kan HIF-2a – ARNT PAS-B * heterodimer störas av små molekyler som binder någon av de två PAS-B-subenheterna, antingen inom deras kärnor eller på β-arkytorna som medierar protein-proteininteraktioner. På grundval av likheten mellan 1 och föreningar som vi tidigare observerade i HIF-2a-ligandkomplex 18, 23, förutsåg vi oss att de direkt skulle kunna binda inom HIF-2α PAS-B * -området. Med användning av NMR-spektroskopi för att jämföra 15 N- 1 H HSQC-spektra för båda PAS-B-domänerna i frånvaro och närvaro av 1 observerades utbredda ligandinducerade spektrala förändringar för HIF-2a PAS-B men inte för motsvarande ARNT PAS-B underenhet (Kompletterande Fig. 3c). Det långsamma utbytesbeteendet för dessa kemiska förändringsförändringar överensstämde med lågmikromolära eller stramare dissociationskonstanter. Dessa bindande affiniteter kvantifierades med användning av isoterm titreringskalorimetri (ITC), rapporterande KD = 1, 1 um och en 1: 1 stökiometri (kompletterande fig. 3d), även om den höga DMSO som krävs för att solubilisera 1 troligen dämpade den verkliga ligandaffiniteten något 17 . Sammantaget fanns det rimligt samband mellan ligandaffinitet och den submikromolära (∼ 0, 4 μM) IC50 som observerades för heterodimerstörning (kompletterande figur 3b).

Ett medicinskt kemiskt arbete genomfördes för att förstå struktur-aktivitetsförhållandena som ligger till grund för förmågan hos 1 att störa HIF-2α – ARNT PAS-B * heterodimerisering 24 . En förbättrad analog, 2, identifierades (fig. La) som också band HIF-2a PAS-B-domänen (fig. 1b – d) med en KD på 81 nM (fig. 1d). Sammantaget indikerar dessa data att denna klass av föreningar fungerar genom att binda HIF-2a direkt.

( a ) Kristallstrukturen i det ternära komplexet av HIF-2 PAS-B * med 2 avslöjar ligandbindning i det inre hålrummet som sekstrerats från bulklösningsmedel inom HIF-2a PAS-B-domänen (grå). För tydlighetens skull visas inte ARNT – PAS-B * -delen av protein heterodimeren, och en del av HIF-2a PAS-B * -ytan (blå) har skurits bort för att avslöja det interna bindningsstället. ( b ) Protein-ligandkontakter som avslöjats genom en utvidgad vy av bindningsstället för 2, vilket visar att det består av en blandning av polära och hydrofoba rester. ( c ) 15 N- 1 H HSQC-spektra på 200 μM [ 15 N] HIF-2α PAS-B (huvudpanelen) och [ 15 N] ARNT PAS-B (inlägg) i närvaro av 0 μM, 125 μM och 250 μM 2 (röd till blå) visar den specifika bindningen av 2 till HIF-2α PAS-B. Endimensionell spår av spektra (på platser visade med prickade linjer) visar långsam utbytesbindningsbeteende mellan 2 till HIF-2a och ingen bindning till ARNT PAS-B. ( d ) ITC-mätningar av 2 till HIF-2a PAS-B kvantifierar bindningsaffiniteten och 1: 1-stökiometri.

Bild i full storlek

Antagonister binder inuti HIF-2a PAS-B inre hålighet

För att ytterligare definiera hur dessa föreningar stör HIF-2α – ARNT PAS-B * heterodimerisering integrerade vi röntgenkristallografiska och högupplösta lösningar NMR-studier av HIF-2α PAS-B bundna till 2. Som förväntat, en samkristallstruktur avslöjade att denna ligand bundet inom det förformade HIF-2a PAS-B inre håligheten (fig. la, b, kompletterande fig. 4 och kompletterande tabell 2) och förskjuter vatten. Förening 2 delar några vanliga strukturella särdrag med de tidigare beskrivna småmolekylliganderna (kompletterande fig. 5), vilket underlättar bindning med en kombination av van der Waals och elektrostatiska interaktioner, inklusive (i) placering av ligandnitrogruppen och linkeramin intill till His248-imidazol-sidokedjan, (ii) en P-vätebindning mellan Tyr281-hydroxyl och A-ringbensenringen och (iii) en intraligand-vätebindning delad mellan aminkopplingen och A-ringens nitrogrupp. Ytterligare undersökning av strukturen antyder att 2 härleder dess högre affinitet från förbättrade van der Waals och elektrostatiska interaktioner. I synnerhet kompletterar den större dihalogenerade B-ringen med 2 bättre den omgivande hydrofoba fickan, som endast delvis ockuperades av B-ringarna från de fragment-härledda föreningarna THS-017, THS-020 och THS-044 som binds med dissociationskonstanter som sträcker sig från 600 nM till 2 μM och lägre molära entalpier 17, 18 (kompletterande figur 5). Dessutom presenterar A-ringen av 2 potentiella nya elektrostatiska interaktioner, speciellt i dess placering av den vätebindande oxadiazolringen intill en av Ser292-sidokedjekonformationer som observerats i det 2 ternära komplexet. På liknande sätt identifiering av B-ringssubstitutioner som bättre komplementerade formen på apo-proteinbindningsstället än de som var närvarande i 1 var nyckeln till utvecklingen av 2 (kompletterande figur 5).

Bundna ligander inducerar HIF-2a PAS-B konformationella förändringar

För att erhålla mekanistisk insikt i kopplingen mellan bindning mellan små molekyler och protein-protein-interaktioner i HIF-2a PAS-B jämförde vi oberoende lösningar och kristallografiska data som erhållits från apo och 2-bundet HIF-2a. HIF-2α PAS-B – 2-komplexet var mottagligt för NMR-studier med hög upplösning (Fig. 1c), vilket tillät oss att tilldela ryggraden kemiska förändringar och jämföra dessa med befintlig apo-proteininformation 9 . Kemiska skiftskillnader som observerades mellan dessa uppsättningar (fig. 2a) fastställde att 2-bindning påverkade många ställen i det omgivande proteinet, vilket fortfarande behåller den blandade a-ß PAS-domänvikten. Kartläggning av dessa skiftändringar på kristallstrukturen (fig. 2a, b), observerade vi många av de största skillnaderna på p-arket (särskilt Hp-, Ip- och Ap-strängarna). Parallella kristallografiska analyser använde en skillnad Fourier-analys av apo och 2-bundet HIF-2α – ARNT. PAS-B * datamängder (med mycket likartade kristallparametrar) visade ligand-associerade förändringar i elektrondensitet både inom HIF-2a-kaviteten och över det angränsande p-arket (fig. 2c). Noterbart observerades nästan ingen F o - F o skillnadstäthet någon annanstans i strukturen, inklusive ARNT PAS-B-subenheten, vilket gav en kraftfull kontroll för artefakter från analysen. Dessa oberoende analyser kopplar ligandbindning till konformationella förändringar vid p-arkytan i HIF-2a PAS-B-domänen, som används för att binda dess ARNT-motsvarighet (kompletterande figur 6), som starkt stödjer ett allosteriskt handlingssätt för vår konstgjorda inhibitorer.

( a ) Ryggrad 1 H och 15 N kemiska skiftskillnader mellan apo och 2-bundna tillstånd kartläggs på HIF-2a PAS-B primära och sekundära strukturer. ( b ) Ligand-inducerade kemiska skiftstörningar kartläggs på HIF-2a PAS-B-struktur med sfärer som anger HIF-2a Ca-platser inom 8 Å från ARNT PAS-B. Vyn är ungefär 180 ° roterad kring y (vertikal) axeln från vyn i figur 1a. Den gul-till-röda färgskalan som visas till höger om a används också i b och kompletterande figur 6. ( c ) Ligandinducerade konformationella förändringar i liknande regioner framgår också av röntgendiffraktionsdata, som avslöjats av en F o (liganded) - F o (apo) elektrondensitetsskillnadskarta (återges vid 4 σ; positiv densitet i grönt, negativ densitet i rött).

Bild i full storlek

Ligand 2 stör selektivt HIF-2-heterodimerisering

Liksom 1 stör de konformationella förändringarna som induceras av 2 störande heterodimerisering av isolerade HIF-2a- och ARNT PAS-B * -domäner i AlphaScreen-analysen (Fig. 3a). Emellertid förmedlas heterodimerisering av de två HIF-subenheterna i full längd genom multipla protein-proteininteraktioner som involverar PAS-A och basiska helix-loop-helix-domäner 10 . För att bestämma om 2 kan antagonisera heterodimerisering mellan HIF-2a och ARNT-polypeptider i full längd, beredde vi nukleära extrakt från hypoxiska Hep3B-celler. En antikropp som känner igen N-terminalen i ARNT 10 användes för att immunutfälla det endogena ARNT-proteinet från kärnkraftsekstrakten (fig. 3b och kompletterande fig. 7). HIF-2a-subenheten samutfälldes med ARNT i extrakt inkuberade med DMSO-vehikelkontrollen. Tillsats av 2 till extrakten minskade emellertid HIF-2a-koimmunutfällningseffektiviteten med mer än en faktor av två på ett dosberoende sätt (Fig. 3b). Storleken av dessa effekter på HIF-2-heterodimerisering liknar den som observerades efter mutation av HIF-2a PAS-B-dimeriseringsgränssnittet 10 .

( a ) Tillsats av 2 blockerar heterodimer-sammansättning mellan renad rekombinant HIF-2a PAS-B * och ARNT PAS-B * heterodimer (kvadrater) såsom bedömdes i AlphaScreen-analysen. Ingen effekt observerades i kontrollreaktioner med användning av ett enda (dubbelt taggat) GST-ARNT – PAS-B * -Flaggprotein som kan rekrytera båda pärlorna för att inducera en AlphaScreen-signal (cirklar). Analyser utfördes i tre exemplar, och felfält representerar ± sd RU, relativa enheter. ( b ) Förening 2 avbryter heterodimerisering av HIF-2-transkriptionsfaktorn i full längd. Kärnekstrakt framställda från hypoxiska Hep3B-celler som uttrycker ARNT, HIF-2a och HIF-1a (inmatning) inkuberades med ökande koncentrationer av 2. Immunblotanalys indikerar mängder av HIF-polypeptider immunutfällda i frånvaro (–Ab) eller närvaro av en antikropp mot ARNT .

Bild i full storlek

Förutom HIF-2a uttrycker Hep3B-celler också HIF-la. Även om dessa två HIF-a-isoformer delar> 70% identitet mellan deras PAS-B-domäner, antyder modellering av HIF-la-PAS-B-domänen på HIF-2a PAS-B-strukturen att flera bulkare rester vetter mot den interna HIF-la hålighet (fig. 4a, b och tilläggsfigur. 8). Sådana förändringar förväntas begränsa fickan och interferera med ligandbindning, och detta bekräftades av ITC-data som visar att 2 effektivt inte binder HIF-la-PAS-B-domänen (Fig. 4c; KD > 5 um). Den stora selektiviteten för 2 för HIF-2a visas i figur 3b, eftersom ökande mängder av 2 har liten effekt på HIF-1-heterodimerisering i full längd, bedömd genom coimmunoprecipitation. Dessa data bekräftar att in vitro binder 2 sig selektivt inom ett förformat ligandbindningsställe som är begravt inom HIF-2a PAS-B-domänen. Att säkerställa att allosteriska konformationella förändringar sprider sig till domänens yta, försvagar interaktioner med ARNT PAS-B-domänen och stör störande heterodimerisering av HIF-2-transkriptionsfaktorn i full längd.

( a ) Jämförelse av inre kavitetsstorlekar (blå) identifierade med en 1, 4-Å-sond inom vår HIF-2a PAS-B-kristallstruktur (PDB-kod 3F1P) 18 (överst) och en homologimodell av HIF-1a PAS-B-domän baserad på denna struktur. Sekvensskillnader mellan dessa två nära besläktade paraloger minskar den förväntade storleken på HIF-1a PAS-B-kaviteten. ( b ) HIF-1a PAS-B-modellen antyder att flera sekvensskillnader mellan dessa paraloger leder till placering av bulkigare sidokedjor (röd) inom HIF-la-PAS-B-kärnan. Dessa substitutioner verkar krympa håligheten som observerats i HIF-2a PAS-B (HIF-2a PAS-B-hålighet gjord som en blå yta, överlagrad på HIF-la-PAS-B-modellen). Aminosyra-skillnader indikeras med den första bokstaven som anger HIF-2-aminosyraidentiteten och den sista bokstaven som anger HIF-1-identiteten. ( c ) ITC-mätningar av en HIF-1a PAS-B – 2-titrering visar inte detekterbar protein-ligandinteraktion under samma förhållanden som användes för att observera bindning med HIF-2a PAS-B (fig. 1d).

Bild i full storlek

Ligand 2 stör selektivt HIF-2 i odlade celler

Den förbättrade in vitro- effekten av 2 ger en möjlighet att validera selektiv HIF-2-antagonism i levande celler. Ingen öppen toxicitet observerades för 786-0 eller Hep3B-celler inkuberade med så mycket som 30 μM av 2 (kompletterande fig 9). Förening 2 metaboliserades inte lätt såsom visas med en halveringstid på 14 h ( t 1/2 ) när de inkuberades med 786-0 celler in vitro ; parallella experiment med endast odlingsmedium visade ingen förlust under 24 timmar (data visas inte). 786-0-cellerna härrörande från ett humant njurcellscarcinom saknar ett funktionellt pVHL, E3-ubiquitin-ligaset som är ansvarigt för att markera HIF-a för proteasomal nedbrytning under normoxiska förhållanden. Dessa celler saknar också detekterbart HIF-la-uttryck så att HIF-beroende reglering av målgener kan hänföras till HIF-2-isoformen som konstitutivt ackumulerar 25 . Tillsats av 2 till odlade 786-0-celler förändrar inte HIF-2a-uttryck varken mRNA (fig. 5a) eller proteinnivå (kompletterande fig. 10). Emellertid reduceras uttrycket av en väl validerad HIF-2- målgen ( VEGFA ) på ett dosberoende sätt i 786-0-celler som inkuberades med 2 i 18 timmar (fig. 5a).

( a, b ) Även om inkubation av 2 med normoxiska 786-0-celler inte har någon effekt på HIF-2a-uttryck (a) avslöjar RT-PCR att 2 antagoniserar expression av HIF-2-målgenerna VEGFA i 786-0-celler (a ) och EPO i Hep3B (b, vänster) celler. Däremot påverkas inte transkription av en HIF-1-selektiv målgen ( PGK1 ) i Hep3B-celler av 2 ( b, höger). ( c ) Förening 2 avbryter selektivt DNA-bindning med HIF-2, men inte HIF-1, i en ChIP-analys. RT-PCR-data för varje gen är medelvärdet av tre värden bestämda från tre oberoende skördade uppsättningar, och felstegen representerar ± sd Skillnader mellan parade värden är statistiskt signifikanta som bestäms av Student's t- test. * P <0, 01; ** P <0, 001; NS, obetydlig.

Bild i full storlek

För att bekräfta att verkningsmoden för HIF-2-hämning med 2 verkligen är beroende av bindning till HIF-2a, undersökte vi ligandeffekter på Hep3B-celler. Även om vissa hypoxiinducerbara målgener regleras av både HIF-1 och HIF-2 i dessa celler, regleras andra gener exklusivt av en enda isoform 26, 27 . För att undersöka EPO- eller PGK1-uttryck som surrogatmarkörer för HIF-2 respektive HIF-1, förinkuberades Hep3B-celler med 1 μM eller 10 μM 2 under 2 timmar och hölls antingen under normoxiska eller under hypoxiska (1% O2) betingelser för 6 timmar eller 12 timmar. Medan hypoxi inducerar både EPO- och PGK1-mRNA-uttryck, antagoniseras endast hypoxisk induktion av EPO-mRNA med 2 (fig. 5b). Inkubation med 2 har ingen effekt på expressionen av PGK1 eller på HIF-la och HIF-2a mRNA-nivåer (kompletterande figur 11).

Om 2 arbetar i celler genom att antagonisera HIF-2-heterodimerisering, bör HIF-2s DNA-bindningsaktivitet likaledes komprometteras selektivt. Kromatinimmunutfällning (ChIP) med användning av antikroppar alstrade mot HIF-la eller HIF-2a användes för att mäta HIF-DNA-bindning i odlade celler. En ökning av både HIF-1 och HIF-2-bindning till ett HIF-responsivt promotorelement observeras under hypoxiska förhållanden, vilket återspeglar ökningen i stabilitet hos båda a-subenheterna. Den DNA-bindande aktiviteten för HIF-1 påverkas emellertid inte i celler som inkuberas med 10 mikrometer 2, medan HIF-2s DNA-bindningsaktivitet minskas väsentligt (fig. 5c). Tillsammans utgör dessa data en bevis-på-princip-demonstration att småmolekylligander direkt och selektivt kan binda en kavitet inom PAS-B-domänen i HIF-2a-polypeptiden. Ligandbindning inducerar konformationella förändringar i HIF-2a som stör bildningen av HIF-2-heterodimeren, antagoniserar HIF-2s DNA-bindningsaktivitet och selektivitet minskar uttrycket av HIF-2-målgener i levande celler.

Diskussion

Stora framsteg har gjorts när det gäller att avslöja förhållandet mellan HIF, hypoxi och tumörprogression och metastaser (granskad i ref. 19, 28). Ökade mängder HIF har observerats bland mänskliga cancer i hjärnan, bröstet, njurarna och äggstockarna, och är ofta förknippade med ökad tumör aggressivitet, terapeutisk resistens och dödlighet 28 . Även om mycket uppmärksamhet har fokuserat på samband mellan HIF-1a och cancer, finns det ökande bevis på att HIF-2α är en viktig drivkraft för ett antal vanliga tumörer 19, 29 . Till exempel har en tydlig roll för HIF-2 i cancer definierats för ett antal VHL-bristiga njurcellscancer där de protumorigena effekterna av stabiliserad HIF-2a inte kan fenokopieras med HIF-1a 6, 7, 8 . På senare tid har HIF-2a erkänts som ett anmärkningsvärt terapeutiskt mål i ett antal genetiskt olika cancerformer 30, inklusive glioblastomas 31, 32 och lungcancer inte-småceller 33 . De underliggande mekanismerna som är ansvariga för en HIF-2-preferens i vissa cancerformer är fortfarande föremål för utredning, även om selektivitet i uttryck, målgener och interaktionspartner har alla varit inblandade 19 .

Ackumulering och aktivitet av HIF-a-subenheten induceras akut efter en minskning av cellulär O2, som ofta uppträder i tumörer. Under normoxi nedbryts a-underenheten snabbt efter O2-beroende hydroxylering av nyckelproliner inom det syreberoende nedbrytningsdomänet, rekryterar pVHL ubiquitin ligas 34, 35 . Parallell O2-beroende hydroxylering av asparaginer i HIF-a C-terminal transaktiveringsdomän kontrollerar också HIF: s förmåga att interagera med vissa transkriptionella koaktivatorer 36, 37 . Emellertid är HIF-a ofta uppbyggda på ett O2-oberoende sätt i tumörer som innehåller lämpliga genetiska förändringar av onkogena signalvägar eller tumörundertryckningsgener. Detta scenario exemplifieras bäst av mutationer som inaktiverar pVHL och resulterar i konstitutiv stabilisering av HIF-a-subenheten, vilket predisponerar patienter för njurcellscancer och en mängd andra cancerformer 38 . Mutationer till många andra proteiner har också visats konstituerande inducera HIF-a, om än med andra mekanismer 28 . HIF-antagonister med små molekyler som direkt binder transkriptionsfaktorn, oberoende av mekanismen som ligger till grund för dess induktion, kan därför ha nytta i ett brett spektrum av sjukdomsstudier.

HIF-2a tillhandahåller ett särskilt tilltalande mål för inhibitorutveckling med tanke på det förformade hålrummet som finns i dess PAS-B-domän. Sådana hålrum är mycket sällsynta i proteindomäner av denna storlek, eftersom de äventyrar en huvudkomponent i den hydrofoba kärnan som normalt stabiliserar en proteinvikning. Trots dess sekvestrering från lösningsmedel har vi tidigare visat att denna kavitet är tillgänglig för små molekylligander in vitro 17, 18 . Här identifierar vi överlägsna föreningar som binder HIF-2a PAS-B-domänen med en KD ∼ 80 nM. Denna klass av föreningar inducerar konformationella förändringar inom domänen efter bindning, med förändringar identifierade vid det kritiska ß-arkgränssnittet som används för att binda ARNT PAS-B (kompletterande figur 12). Noterbart observeras jämförbara förändringar i PAS-domäner med deras kognata naturliga ligander trots skillnader i ligandstruktur och aktiveringsmekanism, vilket antyder en viss grad av bevarande i deras allosteriska aktiveringsprinciper. Till exempel utnyttjar fotosensoriska PAS-domäner, som binder flavin-kromoforer jämförbart med våra konstgjorda HIF-2a-ligander, en förändring i kofaktorkonfiguration via den fotokemiska bildningen av en protein-flavinbindning till störande ß-arkstruktur och proteinbindning 14, 39 (Kompletterande Fig. 12).

Även om flera protein-proteininteraktioner driver HIF-heterodimerisering, är ligandberoende allosteriska förändringar till HIF-2a PAS-B-domänen tillräckliga för att störa bildningen av det endogena HIF-2-komplexet i full längd, med en motsvarande selektiv minskning av HIF-2-aktiviteten i levande celler. Även om HIF PAS-domäner har varit implicerade som mål för HIF-inihibitorer 40, 41, är detta till vår kunskap det första exemplet där de molekylära underlag för sammansatt aktivitet har belysats. Exempelvis rapporterades att akriflavin nyligen antagoniserade HIF efter bindning till HIF-a PAS-B-domänerna 41 . Eftersom denna förening hämmar både HIF-1 och HIF-2 är emellertid ett inre PAS-B-hålighet troligtvis inte det relevanta bindningsstället, eftersom skillnader mellan isoformerna ger utsökt specificitet.

Även om de ursprungligen kännetecknades i samband med deras roll i syreavkänning, svarar HIF: er på en mängd cellulära signaler, inklusive cellulära metaboliter. Exempelvis verkar den näringsavkännande mTOR-vägen uppströms för HIF-a-uttryck, medan mellanliggande metaboliter av Krebs-cykeln påverkar aktiviteten hos HIF-hydroxylaser 42 . Även om våra resultat här ger användbara reagens för HIF-2-hämning, är det frestande att ytterligare spekulera att en sådan ficka har utvecklats för HIF-2-reglering genom endogena metaboliter in vivo . Från ett strukturellt perspektiv stöds denna hypotes av närvaron av sällsynta stora håligheter (såsom i HIF-2a PAS-B) oftast inom apo-former av naturliga ligandbindande proteiner (kompletterande figur 1). Om så är fallet, kan framtida belysning av kognat naturliga ligander ge ny insikt i isoformspecifik metabolisk reglering av HIF i fysiologiska och patologiska miljöer.

metoder

Proteinberedning.

HIF-2α PAS-B (240–350), HIF-2α PAS-B * (240–350, R247E), ARNT PAS-B (355–470) och ARNT PAS-B * (355–470, E362R) domäner uttrycktes och renades såsom tidigare beskrivits 18 . HIF-1a PAS-B (238–349) använd för ITC och HIF-2a PAS-B använd för NMR-studier komplex med 2 uttrycktes med en N-terminal Gp1-fusionstagg 23 och renades genom Source-Q-jonbyte och Superdex S75 storleksuteslutningskromatografi. För HIF-la-PAS-B-domänen avlägsnades inte Gl-taggen, eftersom dess retention förbättrade lösligheten för den renade PAS-B-domänen.

AlphaScreen-proteinreagens uttrycktes som GST-HIF-2a PAS-B * och His 6- Gp1-ARNT – PAS-B * -Flag-fusioner, renade med affinitet (glutation eller Ni (II)) och Superdex S75-kromatografi, jämviktad i AlphaScreen analysbuffert (50 mM Tris (pH 7, 5), 100 mM NaCl; 1 mM ditiotreitol) och snabbfryst i vätska N2.

NMR-analyser.

Proteinskelettresonansuppdrag för HIF-2α PAS-B – 2-komplexet bestämdes med användning av HNCO, HNCACB och CBCA (CO) NH-spektra uppsamlade på en kryoprobe-utrustad Varian Inova 600 MHz-spektrometer från ett prov av 300 μM U- [13C, 15 N] HIF-2a PAS-B, 350 umM 2 och 0, 4% DMSO i 10 mM dll-Tris, pH 7, 3 och 20 mM NaCl-buffert med användning av NMRViewJ 43 . Data som samlats in vid ett andra tillstånd (5 mM MES, pH 6, 5; 20 mM NaCl) användes för att lösa oklarheter som härrör från utvidgning vid utbyte på ett begränsat antal platser. Kemiska skiftdifferenser (fig. 2a, b) beräknades utifrån HIF-2α PAS-B 15 N-1H-uppdrag av komplexet (här) och apo-form 9

AlphaScreen.

Reaktioner utfördes i mikrotiterplattor innehållande 100 nM GST-HIF-2a PAS-B *, 100 nM ARNT-PAS-B * -Flag, 20 mM Tris-Cl (pH 7, 5), 100 mM NaCl, 1 mM DTT, 0, 02% Tween-20, 1, 5 pg / mL AlphaScreen Glutathione donor pärlor (PerkinElmer) och 1, 5 pg / mL AlphaLISA anti-Flag Acceptor Pärlor (PerkinElmer). Sammansatta lager (100 x) framställdes i DMSO. Plattor inkuberades i mörkret vid rumstemperatur med försiktig gungning i 4 timmar före datainsamling med användning av en EnVision-mikroplattläsare (PerkinElmer). Som kontroll ersattes de enskilda PAS-B * -domänerna med ett enda (dubbelt taggat) GST-ARNT-PAS-B * -Flag-protein (230 nM) som kan rekrytera båda pärlorna för att inducera en AlphaScreen-signal.

NMR-ligandbindningsanalys.

Föreningar titrerades vid 125 mikrometer och 250 mikron koncentrationer i prover med 200 mikrometer enhetligt 15 N-märkta HIF-2a och ARNT PAS-B domäner. Förändringar i toppintensitet eller platser i 15 N- 1 H HSQC-spektra indikerade ligandbindning.

Isotermisk titreringskalorimetri av protein-små molekylkomplex.

Termodynamiska parametrar för bindning av små molekyler bestämdes med användning av en MicroCal VP-ITC-kalorimeter. Proteinlösningar dialyserades i stor utsträckning mot buffert (50 mM Tris (pH 7, 5), 20 mM NaCl och 5 mM p-merkaptoetanol), som därefter användes för att framställa en matchad föreningslösning genom utspädning från ett 50-mM föreningsmaterial i 100% DMSO . ITC-data som samlats in för 1 förvärvades i 5, 0% DMSO för att förbättra föreningens löslighet, och data för 2 samlades vid 0, 02% DMSO. Tidigare kontroller har visat blygsamma effekter av 5% DMSO på uppmätta termodynamiska parametrar för HIF-ligandkomplex, vilket vanligtvis reducerar affiniteter med en faktor från två till fyra 17 . Varje isoterm registrerades genom att injicera 200 mikrometer protein (spruta) i 5- till 10 mikrometer lösningar av förening (cell), och redogöra för utspädningsvärmer genom att subtrahera data från en kontrolltitrering av 200 mikrometer protein i en matchad buffert-DMSO-lösning. Termogram var anpassade till en bindningsmodell med en enda plats för att extrahera jämviktsbindande parametrar.

Kristallografi.

Förening 2 kristalliserades som ett ternärt komplex med HIF-2a-ARNT PAS-B * heterodimer 17, 18 . I korthet kristalliserades HIF-2a – ARNT PAS-B * heterodimerer i närvaro av ett stökiometriskt överskott av 2. Ternära komplexkristaller växte i hängande droppar av 2 μl 300 μM ternärt komplex och 2 μl utfällningsmedel (100 mM Bis-Tris (pH 5, 5–6, 0), 20 mM NaCl, 19–23% PEG 3350), som kompletterades med 25% PEG400 före frysning i flytande kväve. Röntgendiffraktionsdata samlades in vid Advanced Photon Source (Argonne National Laboratory, Argonne, IL), strålning ID-19 vid 100 K med användning av 0, 97937-Å röntgenstrålar, vilka reducerades och skalades med mjukvarupaketet HKL2000 44 . Strukturerna bestämdes, förfinades och validerades med användning av PHENIX 45- makromolekylär kristallografisoftwarepaket (version 1.7.2-869) i samband med PRODRG2-webbservern 46 för att generera initiala ligandkoordinater, molekylär modellering med COOT 47, validering med MolProbity 48 och ytterligare analys och beredning av figurer i PyMOL (Schrödinger, Inc.). Den slutliga strukturella modellen förfinades med en beläggning av 2 vid 0, 7, med slutlig förfiningstatistik presenteras i kompletterande tabell 2 (koordinater deponerade vid RCSB med PDB-kod 4GHI). Beräknade väteatomerpositioner sattes till protein- och ligandkoordinatfiler och användes i ett "ridväte" -läge. Den slutliga modellen demonstrerar goda stereokemiska egenskaper, som Ramachandran (100% gynnade) och MolProbity (3.17 (98%) resultat) och 1, 24 (96%) MolProbity-analyser har fått. En F o - F o elektronisk densitetsskillnadskarta (fig. 2c och kompletterande fig. 12a) beräknades med användning av skillnadsstrukturfaktoramplituder härledda från apo- och ligandbunden diffraktionsdata, med faser härledda från atomkoordinaterna för apo-proteinet heterodimer (PDB-kod 3F1P 18 ). Strukturfaktoramplituderna skalades med användning av SCALEIT, och kartor beräknades med användning av FFT, båda från CCP4 (ref. 49) programvarusvit. Homologimodellen för HIF-la PAS-B (fig. 4a, b) genererades med MODELLER 50 med användning av de ligandfria koordinaterna för HIF-2a PAS-B (PDB-kod 3F1P).

Ockupationer för platser som demonstrerade flera konformer optimerades genom fenix.refine inklusive HIF-2a PAS-B kavitetsfoderrester Met252. Eftersom 2 visar fraktionerad (0, 7) beläggning av bindningsställen i kristallen, representeras både apo (Met252-in) och 2-bundna (Met252-out) konformationer i 2m F o- D Fc densitetskartor (kompletterande fig. 4) . Met252-in-konformationen modelleras inte i den slutliga strukturen för tydlighet. Fraktionerad beläggning av 2 är sannolikt en konsekvens av steriska begränsningar som åläggs genom odling av HIF-2a PAS-B * –2-kristaller under samma förhållanden som tidigare använts växa apo heterodimer-kristaller. Detta tillvägagångssätt kan begränsa föreningsinducerade proteinkonformationella förändringar förknippade med PAS-B * heterodimer-störning, vilket minskar HIF-2a PAS-B * –föreningens affiniteter och ligandbesättningar i ternära komplexet.

Identifiering av begravd kavitet.

Håligheter som inte var tillgängliga i lösningsmedel detekterades och volymer kvantifierades med användning av ett internt Python-baserat mjukvaruprogram som utvecklats specifikt för att lokalisera interna, begravda håligheter (tillgängliga på begäran). Programmet använder en rasterbaserad sökning för att identifiera regioner i det lösningsmedels-tillgängliga molekylhöljet där en 1, 4-Å-sond sfär, som ungefär är en vattenmolekyl, kan placeras utan steriskt kolliderar med protein. Intilliggande sond-ockuperade punkter grupperades iterativt i grupper med successivt finare rutnätavstånd. I varje steg kasseras kluster som sträcker sig till lösningsmedlet. Slutligen bestämdes volymer av de sammanhängande klustren som återstår. Detta tillvägagångssätt tillämpades på en icke-redundant delmängd av PDB genererad på basis av sekvenshomologi mellan röntgenkristallstrukturer med 2, 5 Å eller bättre upplösning (genererad av NCBI VAST-verktyget, icke-identifierad datauppsättning = 32 263 kedjor från februari 2012). Kaviteter innehållande HETATM-poster utan vatten, vanligtvis används för ligander och kofaktorer, utesluts från analysen. Denna analys avslöjade 121, 433 hålrum med en medelvolym på 38, 9 Å 3 .

Cell kultur.

Human renalt adenokarcinom 786-0 och hepatocellulärt karcinom Hep3B-celler (AATC) odlades i DMEM-högt glukosmedium (HyClone) kompletterat med 10% (786-0) eller 15% (Hep3B) FBS (Atlanta Biologs), 20 mM HEPES-buffert pH 7, 4, 1 mM natriumpyruvat, 100 U / ml penicillin och 100 ug / ml streptomycin (Invitrogen). Hypoxiska experiment utförda i en särskild inkubator (Coy Laboratory Products Inc) innehållande 1% O 2, 5% CO 2 och balans N 2 . Föreningar tillsattes i DMSO (1% slutlig).

RT-PCR.

Celler uppsamlades med Trizol (Invitrogen) och total RNA extraherades med användning av RNeasy Mini Kit (Qiagen). Efter DNas-behandling syntetiserades cDNA med användning av SuperScript II Reverse Transcriptase (Invitrogen). Kvantitativ RT-PCR i realtid utfördes i tre exemplar med användning av iTaq SYBR Green Supermix med ROX (Bio-Rad) med 7900HT detekteringssystem och programvara Prism (Applied Biosystems, Inc.). Data analyserades med användning av den jämförande CT- metoden 51, och expression normaliserades till cyklofilin B. Data för varje gen är medelvärdet av tre värden bestämda från tre oberoende skördade uppsättningar. Följande primeruppsättningar användes för att amplifiera Cyklofilin B: (TGCCATCGCCAAGGAGTAG; TGCACAGACGGTCACTCAAA), HIF-2α (GCGACAATGACAGCTGACAA; CAGCATCCCGGGACTTCT), EPO (GAGGCCGAGAATATCACGACGGG; TGCCCGACCTCCATCCTCTTCCAG), HIF-1α (TGCCACATCATCACCATATAGAGA; TCCTTTTCCTGCTCTGTTTGG), PGK1 (TTAAAGGGAAGCGGGTCGTTA; TCCATTGTCCAAGCAGAATTTGA) och VEGF1 (CTACCTCCACCATGCCAAGTG; TGATTCTGCCCTCCTCCTTCT).

Coimmunoprecipitation.

Kärnproteinextraktion och co-IP-experiment utfördes som tidigare rapporterats 52 . Följande antikroppar användes för immunoblotanalys: anti-HIF-1a monoklonal musantikropp (BD Biosciences; kat. Nr. 610959; 1: 400 utspädning); anti-EPAS / HIF-2a mus monoklonal antikropp (Novus Biologisk; OBS 100–132; 1: 400 utspädning) och anti-ARNT / HIF-1β mus monoklonal antikropp (Santa Cruz Biotechnology; sc-17811; 1: 800 utspädning).

Chromatin Immunoprecipitation (ChIP).

Experiment utfördes enligt beskrivning 53 med användning av ChIP-IT Express Enzymatic Kit (Active Motif) enligt tillverkarens protokoll. ChIP-analyser utfördes med användning av normal mus-IgG (Santa Cruz Biotechnology; kat. Nr. 2027; 1-2 μg / ml), anti-HIF-2a mus monoklonal antikropp (Novus Biologicals; NB 100–132; 2 mg / ml ) eller monoklonal antikropp mot mus-HIF-la med mus (BD Biosciences; kat. nr. 610958; 2 mg / ml). Genomiskt DNA, fällt ut från en enda 15 cm-platta för varje behandling och upprätthölls parallellt med de prover som användes i genuttrycksanalyser, analyserades med qPCR med användning av primrarna för en human EPO-förstärkare amplikon (ACTCCTGGCAGCAGTGCAGC; CCCTCTCCTTGATGACAATCTCAGC). Det fångade genomiska DNA normaliserades och jämfördes mellan prover som tidigare rapporterats 26, 53 .

786-0 metabola stabilitetsanalyser.

786-0-celler från ATCC (Manassas, VA) pläterades vid 5 000 celler per brunn i 50 mikroliter i 96-brunnars plattor och fick hålla sig över natten i standard RPMI-tillväxtmedium innehållande 10% FBS, 2 mM glutamin, 1 × penicillin-streptomycin, 10 mM HEPES, 1 mM natriumpyruvat och 1 x icke-essentiella aminosyror (alla köpta från Life Technologies, Grand Island, NY). Förening 2 löstes i DMSO vid 2 mM, späddes ytterligare till 4 mikrometer i HI-medium och sattes till cellerna i 50 mikroliter så att den slutliga föreningskoncentrationen var 2 mikrometer. Två ytterligare brunnar innehållande förening och inga celler pläterades för att tjäna som tid 0 ( CO ) och endpoint-lösningsmedelskontroll ( Cp ). Cellerna placerades sedan i en 37 ° C, 5% CO2 inkubator. Vid varje tidpunkt samlades mediet, cellerna tvättades en gång med PBS, och tvätten tillsattes media och slutligen trypsiniserades cellerna, och innehållet sattes till röret innehållande medium och PBS. En lika stor volym metanol tillsattes för att lysa cellerna och fälla ut proteiner. Proverna inkuberades under 10 minuter vid RT och centrifugerades sedan vid 15 000 g under 5 minuter i en mikrocentrifug. Supernatanten analyserades med LC-MS / MS. Analysmetoder utvecklades för 2 med användning av ett Applied Biosystems (Foster City, CA) 3200-QTrap, ett kombinerat trippelt quadrupole-ion-fällinstrument. Moderjonen och de två mest framträdande dotterjonerna följdes för att bekräfta sammansatt identitet, även om endast den vanligaste dotter användes för kvantifiering. En Agilent (Santa Clara, CA) ZORBAX XDB-C18-kolonn, 5-mikrometer packning 4, 6 mm × 50 mm, användes för kromatografi.

En modifierad metod 54 användes för bestämning av halveringstiden för metabolisk stabilitet genom substratutarmning. I korthet beräknades ett "procentuellt återvunnet" antal för C0- och C- ep- proverna pläterade i medium endast för att kontrollera föreningsrelaterade problem såsom löslighet och stabilitet i analysmediet. Detta värde erhölls genom att dela C ep LC-MS / MS toppområdet med C0 topparea och multiplicera med 100. Vanligtvis är acceptabla värden mellan 70-140% 55, även om halveringstider rapporteras för föreningar med lägre procentandel återvunna värden. Ett "procentuellt återstående" värde användes för att bedöma en ämnes metaboliska stabilitet över tid. LC-MS / MS-topparean för det inkuberade provet vid varje tidpunkt delades av LC-MS / MS-toppområdet för tiden 0 ( TO ) provet och multiplicerades med 100. Den naturliga loggen (ln) av procenten av återstående förening plottades sedan mot tid (i min), och en linjär regressionskurva plottades genom y- skärningen vid ln (100). Metabolismen för vissa föreningar visar inte linjär kinetik vid en senare tidpunkt, så dessa tidpunkter är uteslutna. Halveringstiden ( t 1/2 ) beräknades som t 1/2 = 0, 693 / lutning.

Ytterligare kemisk syntetisk information och kemisk karaktäriseringsinformation finns i den kompletterande anmärkningen.

Anslutningskoder.

Protein Data Bank (PDB): Kristallografiska data för HIF-2α – ARNT PAS-B * –2 deponeras under anslutningskod 4GHI.

anslutningar

Primära anslutningar

Proteindatabank

  • 4GHI
  • 4GHI 3d-vy

Hänvisade anslutningar

Proteindatabank

  • 3F1P
  • 3F1P 3d-vy

Kompletterande information

PDF-filer

  1. 1.

    Kompletterande text och figurer

    Kompletterande anmärkning, kompletterande resultat